Agonopterix nodiflorella

Millière, 1867 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records33

Data sources7

Biological traits0

DNA specimens25

eDNA detections25

Sources7 archives

Databases and archives Agonopterix nodiflorella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 9 countries25 detections

DNA & barcodingBOLD25 specimens

01Narrative

Agonopterix nodiflorella is a moth of the family Depressariidae. It is found in most of southern Europe. Leaflets of Ferula ferulago mined by the young larva and the web formed by it on a leaf of Ferula ferulago Young larva Older larva The larvae feed on Ferula communis. They initially mine the leaves of their host plant. They fully mine out a number of leaf fragments. Older larvae live freely between spun leaf segments. Larvae can be found from March to April. Young larvae are green with a black head.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix nodiflorella has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections25

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.01%

Haplotypes2

BIN1

Most divergent pair0.15%

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTACTAATTCGTGCTGAATTAGGTAATCCAGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix rotundellasame genus4.1%Agonopterix carduncellisame genus4.4%Agonopterix broennoeensissame genus4.6%Agonopterix atomellasame genus4.6%Agonopterix straminellasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor6

Museum / vouchered27

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 3≤10 km 2

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 27 records without

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZAF-UMUlocation not on record	17
Philadelphia, US	2
Research Collection of Peter Buchnerlocation not on record	1
Natural History Museum Vienna, Research Collectionlocation not on record	1
University of Copenhagen, Natural History Museum of Denmark, Zoological Museumlocation not on record	1

5 institutions · 22 of 27 vouchered records shown · 5 without an institution code

09Environmental DNA25 detections

Where the DNA of Agonopterix nodiflorella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map9 countries0

mixed oak forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 8.90–23.5

Seasonal swing summer↔winter16.0 °C

Max temp (day)18.0 °C 12.2–26.2

Min temp (night)14.4 °C 4.60–19.3

Precipitation41.2 mm/mo 2.50–129

Air humidity58.5 % 44.5–63.5

Moisture balance-64.4 mm/mo

Vapour deficit774 Pa 504–1,176

Wind speed4.00 m/s

Cloud cover35.2 % 18.8–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)