Agoliinus piceatus

(Robinson, 1946) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Agoliinus

At a glance

Occurrence records1 204

Data sources5

Biological traits0

DNA specimens15

eDNA detections6

Sources5 archives

Databases and archives Agoliinus piceatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 204 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agoliinus piceatus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

181Amostly conserved

205Tmostly conserved

214Amostly conserved

328Amostly conserved

433Amostly conserved

550Gmostly conserved

GACATTATACTTCTTATTTGGCAGATGAGCCGGAATAGTTGGAACTTCATTAAGATTACTAATCCGTGCAGAACTAGGAAACCCAGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agoliinus leopardussame genus3.2%Agoliinus anthracussame genus3.5%Agoliinus aleutussame genus4.1%Agoliinus congregatussame genus7.1%Agoliinus lapponumsame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 204 records

Museum / vouchered1 204

Range

Area of Occupancy AOO240 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 1 109≤1 km 22≤10 km 6

1 137 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence1 204

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	1 138
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	59
University of Alaska Museumlocation not on record	3
Royal British Columbia Museumlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1

6 institutions · 1 204 of 1 204 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Agoliinus piceatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

flood meadow, Athyrium, Caltha leptosepalaunder rocks, dung, wood, meadows w/lupineMarmota dungGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 6.30–13.6

Seasonal swing summer↔winter12.9 °C

Max temp (day)12.8 °C 7.70–19.6

Min temp (night)8.40 °C 3.40–10.5

Precipitation106 mm/mo 91.3–208

Air humidity65.5 % 54.5–71.1

Moisture balance17.2 mm/mo

Vapour deficit399 Pa 317–719

Wind speed5.40 m/s

Cloud cover39.3 % 34.6–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agoliinus piceatus

At a glance

Sources5 archives

At a glance

Record type1 204 records

Range

Museum / Voucheredphysical evidence

Holding institutions2 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 204 records