Agoliinus lapponum

(Gyllenhal, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Agoliinus

At a glance

Occurrence records716

Data sources7

Biological traits0

DNA specimens7

eDNA detections2

Sources7 archives

Databases and archives Agoliinus lapponum's data was compiled from.

GBIFGlobal Biodiversity Information Facility716 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF716 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agoliinus lapponum has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 19 variable positions, in barcode order

214Amostly conserved

312Gmostly conserved

322Amostly conserved

334Tmostly conserved

340Cmostly conserved

343Cmostly conserved

355Cmostly conserved

373Cmostly conserved

397Cmostly conserved

407Cmostly conserved

421Cmostly conserved

478Amostly conserved

484Amostly conserved

490Cmostly conserved

492Gmostly conserved

508Amostly conserved

550Gmostly conserved

574Tmostly conserved

604Amostly conserved

AACATTATACTTCCTATTTGGTAGATGAGCCGGAATAGTTGGAACTTCATTAAGATTACTAATCCGAGCAGAACTAGGGAACCCTGGGAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agoliinus nemoralissame genus6.7%Agoliinus congregatussame genus7.6%Agoliinus piceatussame genus7.8%Agoliinus anthracussame genus8.1%Agoliinus leopardussame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agoliinus lapponum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 207×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Wilson CJ, Angus RB (2006) A chromosomal analysis of eight species of Aphodius Illiger subgenera Agiolinus Schmidt, Agrilinus Mulsant and Rey and Planolinus Mulsant and Rey (Coleoptera: Aphodiidae). Proc Russ Entomol Soc 77: 28-33. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type716 records

Wild obs. + sensor447

Museum / vouchered269

Range

Area of Occupancy AOO1 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 264≤1 km 130≤10 km 50>10 km 1

445 georeferenced · 2 without coordinates

Open the mapobservation + sensor447

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 96≤1 km 101≤10 km 43>10 km 17

257 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence269

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	94
Helsinki, FI	63
Rovaniemi, FI	23
Metsähallituslocation not on record	21
CBDClocation not on record	7
NCMGlocation not on record	4
University of Oulu, Zoological Museumlocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	1
TMPMlocation not on record	1
Oulu, FI	1
Kuopio, FI	1
South Kensington, GB	1

12 institutions · 219 of 269 vouchered records shown · 50 without an institution code

09Environmental DNA2 detections

Where the DNA of Agoliinus lapponum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.80 °C 3.00–8.60

Seasonal swing summer↔winter25.8 °C

Max temp (day)8.70 °C 5.90–11.5

Min temp (night)1.80 °C -0.4–3.90

Precipitation80.2 mm/mo 64.6–95.9

Air humidity62.0 % 59.3–64.6

Moisture balance8.80 mm/mo 1.20–16.3

Vapour deficit409 Pa 346–473

Wind speed3.40 m/s 2.50–4.30

Cloud cover59.1 % 56.5–61.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)