Agoliinus congregatus

(Mannerheim, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Agoliinus

At a glance

Occurrence records489

Data sources6

Biological traits0

DNA specimens20

eDNA detections17

Sources6 archives

Databases and archives Agoliinus congregatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility489 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF489 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD20 specimens

01Narrative

Aphodius congregatus is een keversoort uit de familie bladsprietkevers (Scarabaeidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Mannerheim.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agoliinus congregatus has left across the world's sequence archives.

At a glance

DNA specimens20

BINs3

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

1Gmostly conserved

22Cmostly conserved

178Cmostly conserved

181Gmostly conserved

187Tmostly conserved

190Amostly conserved

205Tmostly conserved

217Cmostly conserved

223Tmostly conserved

241Cmostly conserved

259Cmostly conserved

271Avariable

278Cmostly conserved

304Gmostly conserved

316Cvariable

415Gmostly conserved

433Amostly conserved

469Gmostly conserved

470Avariable

492Gmostly conserved

508Cmostly conserved

550Gmostly conserved

553Cvariable

565Cvariable

601Cmostly conserved

616Cmostly conserved

619Amostly conserved

625Amostly conserved

634Cvariable

652Cvariable

GACTTTATACTTCTTATTTGGCAGATGAGCCGGAATAGTTGGAACTTCATTAAGATTACTAATCCGAGCAGAACTAGGAAACCCAGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BINs3

Most divergent pair3.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agoliinus leopardussame genus7.1%Agoliinus piceatussame genus7.1%Agoliinus lapponumsame genus7.6%Agoliinus anthracussame genus7.9%Agoliinus aleutussame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type489 records

Wild obs. + sensor1

Museum / vouchered488

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 249≤1 km 179≤10 km 5>10 km 2

435 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence488

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	433
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	44
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
University of Alabamalocation not on record	3
Toronto, CA	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

7 institutions · 488 of 488 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Agoliinus congregatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

subalpine Veratrum, Calamagrostiswet meadow w/hummocksmeadow, Neph. cris., Anem. narc.alpine Salix, Valariana, shrubsheath, stream, shallow pond, snow fieldsGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 7.50–12.2

Seasonal swing summer↔winter20.5 °C

Max temp (day)16.2 °C 10.6–18.0

Min temp (night)6.10 °C 3.10–8.20

Precipitation141 mm/mo 109–152

Air humidity60.1 % 55.1–69.5

Moisture balance17.2 mm/mo -1.20–85.7

Vapour deficit528 Pa 318–654

Wind speed3.60 m/s 2.00–5.10

Cloud cover38.9 % 37.9–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)