Agnorisma badinodis

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agnorisma

At a glance

Occurrence records3 191

Data sources6

Biological traits0

DNA specimens19

eDNA detections32

Sources6 archives

Databases and archives Agnorisma badinodis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 191 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 191 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD19 specimens

01Narrative

Agnorisma badinodis (pale-banded dart or spotted-sided cutworm) is a moth of the family Noctuidae. It is found in southern Canada and United States, east of the 100th meridian, and exclusive of the Deep South. The wingspan is about 36 mm. There is one generation per year. Recorded food plants include Stellaria media, Sisymbrium officinale, Trifolium, Medicago sativa, Rumex, Symphyotrichum ericoides and Triticum aestivum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnorisma badinodis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

34Gvariable

82Cmostly conserved

100Amostly conserved

133Tvariable

160Avariable

214Amostly conserved

385Tvariable

397Tmostly conserved

479Cvariable

517Avariable

532Cmostly conserved

550Avariable

553Cvariable

565Amostly conserved

577Avariable

616Tmostly conserved

628Gvariable

631Amostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGGATAGTAGGAACTTCTTTAAGACTATTAATCCGAGCTGAATTAGGAAACCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes8

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnorisma bolliisame genus6.4%Adelphagrotis indeterminatasame family6.4%Eugnorisma eminenssame family6.4%Xestia ashworthiisame family6.5%Agnorisma bugraisame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 191 records

Wild obs. + sensor2 786

Museum / vouchered405

Range

Area of Occupancy AOO6 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 442≤1 km 376≤10 km 111>10 km 313

2 242 georeferenced · 544 without coordinates

Open the mapobservation + sensor2 786

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 52≤1 km 87≤10 km 167>10 km 35

341 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence405

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	104
King Saud Universitylocation not on record	84
New Haven, US	50
ASUlocation not on record	48
CUlocation not on record	37
Georgia Museum of Natural Historylocation not on record	22
Mississippi State, US	22
UDlocation not on record	3
Colorado State Universitylocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Cornell University Insect Collectionlocation not on record	2
Toronto, CA	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Champaign, US	1
Decorah, US	1
Denver, US	1
Natural History Museum of Utahlocation not on record	1
Cambridge, US	1
Philadelphia, US	1

19 institutions · 386 of 405 vouchered records shown · 19 without an institution code

09Environmental DNA32 detections

Where the DNA of Agnorisma badinodis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 12.4–18.5

Seasonal swing summer↔winter23.6 °C

Max temp (day)20.7 °C 16.4–23.7

Min temp (night)11.2 °C 8.80–17.0

Precipitation95.3 mm/mo 86.5–113

Air humidity56.7 % 55.4–59.8

Moisture balance-16.4 mm/mo -36.3–7.40

Vapour deficit733 Pa 641–925

Wind speed4.50 m/s 2.50–5.20

Cloud cover44.2 % 33.8–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agnorisma badinodis

At a glance

Sources6 archives

At a glance

Record type3 191 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 191 records