Agnorisma bugrai

Koçak, 1983 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agnorisma

At a glance

Occurrence records624

Data sources6

Biological traits0

DNA specimens36

eDNA detections36

Sources6 archives

Databases and archives Agnorisma bugrai's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility624 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF624 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD36 specimens

01Narrative

Agnorisma bugrai, the collard dart, is a moth of the family Noctuidae. The species was first described by Ahmet Ömer Koçak in 1983.Note that sources vary as to the spelling of the authority's name. It has a transcontinental distribution in North America, from central Canada and the northern United States, southward in the Rocky Mountains to Colorado. The wingspan is about 25 mm. Adults are on wing from August to September depending on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnorisma bugrai has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections36

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

107Cmostly conserved

136Cmostly conserved

499Tmostly conserved

631Tvariable

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes7

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Netrocerocora quadrangulasame family4.9%Sineugraphe exustasame family5.5%Xestia plebeiasame family5.6%Lycophotia molothinasame family5.8%Adelphagrotis indeterminatasame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type624 records

Wild obs. + sensor100

Museum / vouchered524

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 43≤1 km 17≤10 km 8>10 km 8

76 georeferenced · 24 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 84≤1 km 62≤10 km 51>10 km 7

204 georeferenced · 320 without coordinates

Open the institutions mapphysical evidence524

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	208
Colorado State Universitylocation not on record	73
East Lansing, US	53
New Haven, US	42
Denver, US	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	24
Oregon State Arthropod Collectionlocation not on record	22
St. Paul, US	13
Vernal, US	9
Mississippi State, US	6
Albuquerque, US	3
Toronto, CA	1

12 institutions · 488 of 524 vouchered records shown · 36 without an institution code

09Environmental DNA36 detections

Where the DNA of Agnorisma bugrai was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

Temperate mixed forest4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C -3.20–17.6

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.9 °C 1.20–25.2

Min temp (night)8.50 °C -7.40–11.8

Precipitation38.4 mm/mo 29.2–84.6

Air humidity51.4 % 49.8–61.8

Moisture balance-57.8 mm/mo -58.9–24.6

Vapour deficit871 Pa 191–980

Wind speed2.20 m/s 1.50–3.40

Cloud cover40.8 % 37.0–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)