Adelphagrotis indeterminata

Walker, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Adelphagrotis

At a glance

Occurrence records393

Data sources7

Biological traits0

DNA specimens39

eDNA detections39

Sources7 archives

Databases and archives Adelphagrotis indeterminata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF393 records

Environmental DNA1 datasets · 2 countries39 detections

DNA & barcodingBOLD39 specimens

01Narrative

Adelphagrotis indeterminata is a moth of the family Noctuidae. It is found from British Columbia to California. The wingspan is 30–40 mm. Adults are usually on wing from August to October, but they have been recorded flying in May to July.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelphagrotis indeterminata has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes1

eDNA detections39

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

74Tmostly conserved

85Tvariable

121Cvariable

187Tvariable

211Avariable

232Tvariable

235Tvariable

412Amostly conserved

536Cvariable

539Tvariable

589Tmostly conserved

616Tvariable

634Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes8

BINs2

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelphagrotis stellarissame genus2.9%Abagrotis alternatasame family3.5%Abagrotis vittifronssame family3.6%Xestia c-nigrumsame family3.6%Abagrotis trigonasame family3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type393 records

Wild obs. + sensor179

Museum / vouchered214

Origin

Native3

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 107≤1 km 16≤10 km 11>10 km 13

147 georeferenced · 32 without coordinates

Open the mapobservation + sensor179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 44≤1 km 17≤10 km 33>10 km 2

96 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence214

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	46
San Diego, US	45
New Haven, US	39
Oregon State Arthropod Collectionlocation not on record	30
Vernal, US	10
Colorado State Universitylocation not on record	7
St. Paul, US	4
National Institute of Biological Resourceslocation not on record	3
Los Angeles, US	3
ASUlocation not on record	3
Helsinki, FI	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
East Lansing, US	2
Denver, US	1
WWUlocation not on record	1

15 institutions · 198 of 214 vouchered records shown · 16 without an institution code

09Environmental DNA39 detections

Where the DNA of Adelphagrotis indeterminata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map2 countries0

MarshForest1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland3. Shrubland|3.8. Mediterranean-type Shrubby…Upland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 15.5–22.4

Seasonal swing summer↔winter10.1 °C

Max temp (day)25.4 °C 18.4–30.2

Min temp (night)13.4 °C 10.2–18.4

Precipitation13.6 mm/mo 4.80–60.8

Air humidity57.6 % 47.1–65.4

Moisture balance-101 mm/mo -132–-47.1

Vapour deficit881 Pa 642–1,368

Wind speed1.70 m/s 1.40–3.30

Cloud cover21.8 % 12.5–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)