Adelphagrotis stellaris

Grote, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Adelphagrotis

At a glance

Occurrence records187

Data sources7

Biological traits0

DNA specimens30

eDNA detections29

Sources7 archives

Databases and archives Adelphagrotis stellaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD30 specimens

01Narrative

Adelphagrotis stellaris is a moth of the family Noctuidae. It is found along the West Coast from southern British Columbia east to the Cascades in the north and southward to the central California Coast Range. The wingspan is about 36 mm. Adults are on wing from July to August. The larvae feed on a wide range of flowering trees and shrubs, including Vaccinium, Symphoricarpos, Rubus spectabilis and Oemleria cerasiformis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelphagrotis stellaris has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

7Gmostly conserved

40Amostly conserved

178Cmostly conserved

214Amostly conserved

277Amostly conserved

466Gmostly conserved

AACATTGTATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes9

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelphagrotis indeterminatasame genus2.9%Spaelotis bicavasame family4.6%Abagrotis vittifronssame family4.7%Abagrotis alternatasame family4.9%Spaelotis havilaesame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor56

Museum / vouchered131

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 35≤1 km 10≤10 km 1

46 georeferenced · 10 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 2≤1 km 9≤10 km 26>10 km 4

41 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	43
New Haven, US	33
University of Alberta Museums (UAM)location not on record	14
Vernal, US	5
East Lansing, US	5
Essig Museum of Entomologylocation not on record	3
National Institute of Biological Resourceslocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
St. Paul, US	1
Centre for Biodiversity Genomicslocation not on record	1
WWUlocation not on record	1

11 institutions · 109 of 131 vouchered records shown · 22 without an institution code

09Environmental DNA29 detections

Where the DNA of Adelphagrotis stellaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 15.2–17.8

Seasonal swing summer↔winter11.1 °C

Max temp (day)21.0 °C 17.6–24.1

Min temp (night)12.8 °C 12.2–13.7

Precipitation38.9 mm/mo 22.1–111

Air humidity61.0 % 59.1–64.8

Moisture balance-86.5 mm/mo -115–0.7

Vapour deficit688 Pa 644–769

Wind speed2.30 m/s 1.20–4.10

Cloud cover31.3 % 29.9–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)