Abagrotis trigona

Smith, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records365

Data sources7

Biological traits0

DNA specimens43

eDNA detections50

Sources7 archives

Databases and archives Abagrotis trigona's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF365 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD43 specimens

01Narrative

Abagrotis trigona, the luteous dart, is a moth of the family Noctuidae. The species was first described by Smith in 1893. It is found in North America from western South Dakota and south-western Manitoba west across southern Saskatchewan and Alberta to Vancouver Island, south to the Mexican border. There is also a disjunct population in Ohio. The wingspan is 28–30 mm. Adults are on wing in August.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis trigona has left across the world's sequence archives.

At a glance

DNA specimens43

BINs2

Marker genes1

eDNA detections50

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.27%

Haplotypes1

BINs2

Where individuals differ — all 1 variable positions, in barcode order

616Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGCTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis alternatasame genus2.3%Abagrotis forbesisame genus2.4%Abagrotis vittifronssame genus2.4%Abagrotis duancasame genus2.7%Abagrotis striatasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type365 records

Wild obs. + sensor34

Museum / vouchered331

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 5≤1 km 8≤10 km 11>10 km 3

27 georeferenced · 7 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 62≤1 km 5≤10 km 73>10 km 2

142 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	89
University of Alberta Museums (UAM)location not on record	72
Oregon State Arthropod Collectionlocation not on record	34
Colorado State Universitylocation not on record	28
Vernal, US	22
Royal Saskatchewan Museumlocation not on record	13
US	11
East Lansing, US	9
Helsinki, FI	8
OSUClocation not on record	5
Mississippi State, US	3
Albuquerque, US	3
National Institute of Biological Resourceslocation not on record	3
St. Paul, US	3
San Diego, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Denver, US	1
Santa Cruz, US	1

18 institutions · 309 of 331 vouchered records shown · 22 without an institution code

09Environmental DNA50 detections

Where the DNA of Abagrotis trigona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 13.7–20.8

Seasonal swing summer↔winter23.4 °C

Max temp (day)26.2 °C 20.8–28.0

Min temp (night)12.7 °C 6.20–14.1

Precipitation27.9 mm/mo 13.5–39.3

Air humidity50.4 % 43.8–54.1

Moisture balance-102 mm/mo -151–-50.6

Vapour deficit1,127 Pa 747–1,302

Wind speed1.90 m/s 1.50–3.90

Cloud cover32.3 % 12.7–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)