Agapostemon semimelleus

Cockerell, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Agapostemon

At a glance

Occurrence records182

Data sources6

Biological traits0

DNA specimens12

eDNA detections12

Sources6 archives

Databases and archives Agapostemon semimelleus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF182 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Agapostemon semimelleus is een vliesvleugelig insect uit de familie Halictidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1900 door Cockerell.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapostemon semimelleus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

eDNA detections12

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes1

BINs3

Where individuals differ — all 46 variable positions, in barcode order

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

43Avariable

49Tmostly conserved

50Tmostly conserved

73Amostly conserved

88Amostly conserved

109Amostly conserved

181Tmostly conserved

184Amostly conserved

193Tmostly conserved

205Cmostly conserved

206Cvariable

217Avariable

220Tmostly conserved

271Tmostly conserved

283Cmostly conserved

310Tmostly conserved

322Amostly conserved

337Tmostly conserved

340Cvariable

343Tmostly conserved

358Tmostly conserved

364Tmostly conserved

418Tmostly conserved

456Cmostly conserved

490Tmostly conserved

494Amostly conserved

496Avariable

535Cmostly conserved

536Tvariable

559Tmostly conserved

616Cmostly conserved

619Cmostly conserved

625Amostly conserved

634Cmostly conserved

638Amostly conserved

639Tmostly conserved

640Cmostly conserved

641Tmostly conserved

AATATTATATTTCATTTTTGCTATATGATCAGGAATAATTGGATCATCTTTAAGAATATTAATTCGAATAGAACTAAGAACCCCTGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapostemon melliventrissame genus12.5%Agapostemon splendenssame genus12.9%Agapostemon texanussame genus13.0%Agapostemon poeyisame genus13.7%Agapostemon obliquussame genus13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type182 records

Wild obs. + sensor3

Museum / vouchered179

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 8≤10 km 14

22 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	70
	50
Beltsville, US	41
Cambridge, US	9
USP-IBlocation not on record	5
UnBlocation not on record	2
PUC-RSlocation not on record	2

7 institutions · 179 of 179 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Agapostemon semimelleus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 15.6–25.6

Seasonal swing summer↔winter10.5 °C

Max temp (day)24.9 °C 19.5–30.2

Min temp (night)16.8 °C 11.9–21.8

Precipitation113 mm/mo 48.0–178

Air humidity65.8 % 62.4–69.1

Moisture balance-5.20 mm/mo -31.6–21.2

Vapour deficit888 Pa 546–1,231

Wind speed2.40 m/s 1.90–2.90

Cloud cover45.0 % 41.4–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)