Agapostemon obliquus

(Provancher, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Agapostemon

At a glance

Occurrence records686

Data sources7

Biological traits1

DNA specimens12

eDNA detections2

Sources7 archives

Databases and archives Agapostemon obliquus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility686 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF686 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD12 specimens

01Narrative

Agapostemon obliquus is a species of sweat bee in the family Halictidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.99 mm

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapostemon obliquus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

48Cmostly conserved

49Amostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

57Tmostly conserved

103Tmostly conserved

135Amostly conserved

162Tmostly conserved

165Tmostly conserved

172Tmostly conserved

181Amostly conserved

184Tmostly conserved

187Cmostly conserved

202Amostly conserved

220Amostly conserved

259Cmostly conserved

277Amostly conserved

340Cmostly conserved

347Tmostly conserved

364Tmostly conserved

427Tmostly conserved

462Tmostly conserved

524Amostly conserved

530Amostly conserved

535Amostly conserved

541Amostly conserved

553Tmostly conserved

616Cmostly conserved

AATATTATACTTTATTTTTGCTATATGATCAGGAATAATTGGATCTTCACTTAGAATATTAATTCGTATAGAATTAAGAATCCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapostemon sericeussame genus1.8%Agapostemon melliventrissame genus9.0%Agapostemon texanussame genus10.2%Agapostemon poeyisame genus10.6%Agapostemon splendenssame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type686 records

Wild obs. + sensor3

Museum / vouchered683

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 21≤10 km 17>10 km 20

60 georeferenced · 623 without coordinates

Open the institutions mapphysical evidence683

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	386
	74
Awka, NG	69
Beltsville, US	56
Cambridge, US	26
WIlocation not on record	22
Colorado State Universitylocation not on record	15
Wuzhou, CN	14
Universidad Católica de Manizaleslocation not on record	14
Albuquerque, US	5
University of Arizona, Insect Collectionlocation not on record	2

11 institutions · 683 of 683 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Agapostemon obliquus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.4–22.4

Seasonal swing summer↔winter20.4 °C

Max temp (day)29.0 °C

Min temp (night)15.2 °C

Precipitation22.0 mm/mo

Air humidity41.8 %

Moisture balance-89.3 mm/mo

Vapour deficit1,573 Pa

Wind speed2.60 m/s

Cloud cover18.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)