Agapostemon poeyi

(Lucas, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Agapostemon

At a glance

Occurrence records163

Data sources5

Biological traits0

DNA specimens4

eDNA detections0

Sources5 archives

Databases and archives Agapostemon poeyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility163 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF163 records

DNA & barcodingBOLD4 specimens

01Narrative

Agapostemon poeyi is een vliesvleugelig insect uit de familie Halictidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1856 door Lucas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapostemon poeyi has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

300Gmostly conserved

343Cmostly conserved

652Cmostly conserved

AATATTATATTTTATTTTTGCTATATGATCAGGAATAATTGGATCTTCATTAAGTATATTAATTCGAATAGAATTAAGAATTCCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapostemon splendenssame genus7.6%Agapostemon texanussame genus8.3%Agapostemon sericeussame genus10.5%Agapostemon obliquussame genus10.6%Agapostemon femoratussame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type163 records

Wild obs. + sensor101

Museum / vouchered62

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 69≤1 km 10≤10 km 2>10 km 16

97 georeferenced · 4 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤1 km 4≤10 km 10>10 km 11

25 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	28
Cambridge, US	21
Wuzhou, CN	9
US	3
OSUClocation not on record	1

5 institutions · 62 of 62 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)