Agapostemon angelicus

Cockerell, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Agapostemon

At a glance

Occurrence records25 025

Data sources7

Biological traits1

DNA specimens72

eDNA detections109

Sources7 archives

Databases and archives Agapostemon angelicus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 025 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI109 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF25 025 records

Environmental DNA1 datasets · 3 countries109 detections

DNA & barcodingBOLD72 specimens

01Narrative

Agapostemon angelicus, the Angeles striped sweat bee, is a species of sweat bee in the family Halictidae native to North America. Unlike apid bees, members of the Halictidae family are not honey-producers, although they still are pollinators.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.8 mm

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapostemon angelicus has left across the world's sequence archives.

At a glance

DNA specimens72

BINs1

Marker genes1

eDNA detections109

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P558 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

81Gmostly conserved

462Cmostly conserved

516Tmostly conserved

525Tmostly conserved

ATATTTAATACTATTGTTACTTCTCACGCATTCATTATAATCTTTTTTATAGTTATACCATTTATAATTGGTGGTTTTGGGAATTGATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes9

BIN1

Most divergent pair0.36%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapostemon texanussame genus8.6%Agapostemon poeyisame genus10.0%Agapostemon sericeussame genus11.1%Agapostemon obliquussame genus11.3%Agapostemon femoratussame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 025 records

Wild obs. + sensor82

Museum / vouchered24 938

Other5

Origin

Native1

Range

Area of Occupancy AOO9 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 50≤1 km 9≤10 km 3>10 km 10

72 georeferenced · 10 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 4 917≤1 km 647≤10 km 573>10 km 181

6 318 georeferenced · 18 620 without coordinates

Open the institutions mapphysical evidence24 938

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	13 109
Universidad Católica de Manizaleslocation not on record	4 689
	1 169
Wuzhou, CN	1 079
Lubbock, US	1 033
US	1 013
University of Alabamalocation not on record	955
Colorado State Universitylocation not on record	351
Essig Museum of Entomologylocation not on record	316
Awka, NG	175
Provo, US	170
Albuquerque, US	165
Budapest, HU	161
Champaign, US	107
College Station, US	87
CNBLlocation not on record	68
UMSPlocation not on record	44
US	43
Cambridge, US	40
WIlocation not on record	33
OSUClocation not on record	20
Montana State Entomology Collectionlocation not on record	16
Department of Biologics Researchlocation not on record	9
ASUlocation not on record	9
MAPClocation not on record	8
San Diego, US	7
Mexico City, MX	5
WSUClocation not on record	5
UWYMEDlocation not on record	4
New Haven, US	4
University of Arizona, Insect Collectionlocation not on record	3
Denton, US	2
EL PASO, US	2
LS, CNBLlocation not on record	2
CBGlocation not on record	2
San Francisco, US	2
Centre for Biodiversity Genomicslocation not on record	1
ECOSUR-SClocation not on record	1
Los Angeles, US	1
York University, Packer Collectionlocation not on record	1

40 institutions · 24 911 of 24 938 vouchered records shown · 27 without an institution code

09Environmental DNA109 detections

Where the DNA of Agapostemon angelicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found109

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 109 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 10.9–30.0

Seasonal swing summer↔winter19.9 °C

Max temp (day)28.7 °C 17.8–36.0

Min temp (night)14.9 °C 4.60–22.2

Precipitation27.4 mm/mo 11.8–65.2

Air humidity44.0 % 38.9–49.5

Moisture balance-91.8 mm/mo -148–-47.7

Vapour deficit1,481 Pa 697–2,271

Wind speed2.70 m/s 2.40–3.30

Cloud cover20.4 % 14.0–31.7

CHELSA 1981–2010, ~9 km grid, at location & month of 108 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agapostemon angelicus

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type25 025 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type25 025 records