Agapanthia violacea

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Agapanthia

At a glance

Occurrence records1 680

Data sources7

Biological traits0

DNA specimens4

eDNA detections1

Sources7 archives

Databases and archives Agapanthia violacea's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 680 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 680 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD4 specimens

01Narrative

Agapanthia violacea is a species of flat-faced longhorn beetle belonging to the family Cerambycidae, subfamily Lamiinae. This beetle is present in most Europe and in the Near East. The different coloration between male and female demonstrates the great variability of colours. Male and female (Donetsk, Ukraine) The adults grow up to 7 - and can be encountered from May through August, completing their life cycle in one year. They are polyphagous on herbaceous plants, mainly feeding on Medicago sativa, Onobrychis viciifolia, Centranthus ruber, as well as on Scabiosa, Echium, Psoralea, Valeriana and Salvia species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapanthia violacea has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes2

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

89Avariable

AACTTTATATTTTATTTTTGGTTCATGAGCAGCCATATTAGGAACTTCACTAAGAGTATTAATTCGGTCAGAATTAGGTAATCCCGGGAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapanthia intermediasame genus2.0%Agapanthia carduisame genus12.3%Atomaria stricticollissame order14.1%Neopyrochroa flabellatasame order15.2%Neopyrochroa femoralissame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 680 records

Wild obs. + sensor1 363

Museum / vouchered282

Other35

Range

Area of Occupancy AOO3 688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 139≤1 km 111≤10 km 858>10 km 23

1 131 georeferenced · 232 without coordinates

Open the mapobservation + sensor1 363

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 7≤1 km 53≤10 km 103>10 km 24

187 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	60
Muzeum Górnośląskie w Bytomiulocation not on record	56
Provincia di Livornolocation not on record	34
Musee d'Histoire Naturallelocation not on record	9
Nijmegen, NL	9
Winterthur, CH	9
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	8
Tartu, EE	8
Helsinki, FI	7
Vitoria, ES	7
Adam Mickiewicz University in Poznańlocation not on record	5
Tilburg, NL	4
NMOKlocation not on record	2
RBINS-Scientific Heritagelocation not on record	1
GVlocation not on record	1

15 institutions · 220 of 282 vouchered records shown · 62 without an institution code

09Environmental DNA1 detections

Where the DNA of Agapanthia violacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agapanthia violacea

At a glance

Sources7 archives

At a glance

Record type1 680 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 680 records