Agapanthia cardui

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Agapanthia

At a glance

Occurrence records6 598

Data sources7

Biological traits0

DNA specimens79

eDNA detections67

Sources7 archives

Databases and archives Agapanthia cardui's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 598 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 598 records

Environmental DNA1 datasets · 8 countries67 detections

DNA & barcodingBOLD79 specimens

01Narrative

Agapanthia cardui is a species of flat-faced longhorn beetle belonging to the family Cerambycidae, subfamily Lamiinae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapanthia cardui has left across the world's sequence archives.

At a glance

DNA specimens79

BINs4

Marker genes3

eDNA detections67

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 101 variable positions, in barcode order

10Cmostly conserved

16Tmostly conserved

22Amostly conserved

34Amostly conserved

38Tmostly conserved

56Amostly conserved

58Cmostly conserved

59Cmostly conserved

61Gmostly conserved

67Tmostly conserved

73Amostly conserved

74Tmostly conserved

79Amostly conserved

85Tmostly conserved

91Cmostly conserved

100Tmostly conserved

103Tmostly conserved

112Tmostly conserved

133Tmostly conserved

136Tmostly conserved

163Amostly conserved

169Cmostly conserved

172Tvariable

178Tmostly conserved

181Gmostly conserved

184Amostly conserved

190Gmostly conserved

196Amostly conserved

199Amostly conserved

214Gmostly conserved

217Gmostly conserved

220Cmostly conserved

226Tmostly conserved

232Tmostly conserved

238Amostly conserved

241Tmostly conserved

253Amostly conserved

265Amostly conserved

268Tmostly conserved

271Avariable

277Avariable

278Tmostly conserved

286Cmostly conserved

301Amostly conserved

312Gmostly conserved

313Amostly conserved

316Gmostly conserved

319Avariable

337Tmostly conserved

340Tmostly conserved

343Tmostly conserved

346Tmostly conserved

355Avariable

361Tmostly conserved

364Tmostly conserved

367Cmostly conserved

370Tmostly conserved

386Cmostly conserved

400Gmostly conserved

401Tvariable

412Cmostly conserved

418Tmostly conserved

421Tmostly conserved

428Tmostly conserved

433Avariable

448Cmostly conserved

451Avariable

455Gmostly conserved

463Cmostly conserved

469Tmostly conserved

475Amostly conserved

478Tmostly conserved

490Tmostly conserved

493Amostly conserved

494Tmostly conserved

496Amostly conserved

499Tmostly conserved

508Tmostly conserved

514Amostly conserved

523Tmostly conserved

526Tmostly conserved

536Tmostly conserved

538Amostly conserved

544Tmostly conserved

548Cmostly conserved

556Tmostly conserved

557Tmostly conserved

562Amostly conserved

568Tmostly conserved

574Tmostly conserved

586Tmostly conserved

589Tmostly conserved

607Amostly conserved

610Tmostly conserved

616Cmostly conserved

619Amostly conserved

628Gmostly conserved

631Tmostly conserved

634Tmostly conserved

646Cmostly conserved

652Tmostly conserved

AACTTTATACTTTATTTTTGGATCATGAGCAGCAATATTAGGAACTTCATTAAGAATCCTGATTCGTTCAGAATTAGGAAACCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes29

BINs4

Most divergent pair12.8%

EuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapanthia suturalissame genus11.1%Agapanthia violaceasame genus12.3%Aerenea impetiginosasame family14.6%Chrysogaster virescenssame order15.0%Esthlogena porosasame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type6 598 records

Wild obs. + sensor5 962

Museum / vouchered621

Fossil1

Other14

Origin

Native128

Range

Area of Occupancy AOO14 504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 1 137≤1 km 588≤10 km 2 048>10 km 94

3 867 georeferenced · 2 095 without coordinates

Open the mapobservation + sensor5 962

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 12≤1 km 93≤10 km 434>10 km 11

550 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence621

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	170
Vitoria, ES	61
Zürich, CH	40
Paro, BT	40
Helsinki, FI	30
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	20
Bern, CH	14
Provincia di Livornolocation not on record	13
Fribourg, CH	10
Geneva, CH	10
GVlocation not on record	9
Muzeum Górnośląskie w Bytomiulocation not on record	8
NTNU-VMlocation not on record	7
Nijmegen, NL	7
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	7
RBINS-Scientific Heritagelocation not on record	6
Paris, FR	6
Salzburg, AT	4
IMEDEAlocation not on record	3
Museu Nacional de História Natural e da Ciêncialocation not on record	3
Musee d'Histoire Naturallelocation not on record	2
Tartu, EE	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Banyoles, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1

25 institutions · 474 of 621 vouchered records shown · 146 without an institution code

09Environmental DNA67 detections

Where the DNA of Agapanthia cardui was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map8 countries0

auf Trockenrasen gekeschertauf einer RuderalflÃ¤che gekeschertauf Kalkmagerrasen und an Ackerrainen gekesc…an Wegrainen gekeschert und geklopftRivuline vegetationRiparian forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 13.5–21.4

Seasonal swing summer↔winter17.1 °C

Max temp (day)20.0 °C 17.4–23.5

Min temp (night)9.80 °C 8.50–16.4

Precipitation62.4 mm/mo 36.7–98.2

Air humidity58.1 % 53.8–60.3

Moisture balance-61.3 mm/mo -119–-23.1

Vapour deficit787 Pa 645–1,008

Wind speed2.90 m/s 1.90–4.30

Cloud cover37.8 % 33.8–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 66 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agapanthia cardui

At a glance

Sources7 archives

At a glance

Record type6 598 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 598 records