Agapanthia intermedia

Ganglbauer, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Agapanthia

At a glance

Occurrence records863

Data sources7

Biological traits0

DNA specimens14

eDNA detections6

Sources7 archives

Databases and archives Agapanthia intermedia's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility863 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF863 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agapanthia intermedia is a species of longhorn beetle in the subfamily Lamiinae found in Central and Eastern Europe, Romania, Slovakia, and the Netherlands and Kazakhstan. The colour of the species is black. It flies from May to June, and feeds on Knautia arvensis.Colour

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agapanthia intermedia has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

14Amostly conserved

15Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

22Cvariable

23Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Cmostly conserved

34Cmostly conserved

35Amostly conserved

36Tmostly conserved

38Tmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Gvariable

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Cmostly conserved

53Amostly conserved

54Gmostly conserved

56Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Gmostly conserved

69Cmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Avariable

80Amostly conserved

81Amostly conserved

85Cmostly conserved

160Gmostly conserved

166Amostly conserved

169Cmostly conserved

170Amostly conserved

181Tmostly conserved

187Tmostly conserved

202Cmostly conserved

212Tmostly conserved

220Tvariable

235Tmostly conserved

316Gmostly conserved

340Tvariable

346Tmostly conserved

373Amostly conserved

400Avariable

406Tmostly conserved

430Amostly conserved

433Gmostly conserved

473Gmostly conserved

475Avariable

478Cvariable

499Gvariable

536Tmostly conserved

550Gmostly conserved

565Amostly conserved

619Tmostly conserved

622Gmostly conserved

625Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGCTCATGAGCAGCCATATTAGGGACTTCACTAAGAGTATTAATTCGGTCAGAATTAGGAAATCCCGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes7

BINs4

Most divergent pair2.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agapanthia violaceasame genus2.0%Atomaria stricticollissame order13.8%Stenocorus vestitussame family15.5%Chrysobothris carinipennissame order15.8%Neopyrochroa femoralissame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type863 records

Wild obs. + sensor781

Museum / vouchered82

Range

Area of Occupancy AOO2 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 246≤1 km 152≤10 km 194>10 km 15

607 georeferenced · 174 without coordinates

Open the mapobservation + sensor781

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 3≤1 km 10≤10 km 9

22 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tallinn, EE	22
ZSMlocation not on record	2
Philadelphia, US	1
Provincia di Livornolocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

5 institutions · 27 of 82 vouchered records shown · 55 without an institution code

09Environmental DNA6 detections

Where the DNA of Agapanthia intermedia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

Auwald

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 8.20–16.9

Seasonal swing summer↔winter17.8 °C

Max temp (day)16.9 °C 11.9–21.2

Min temp (night)7.60 °C 3.80–11.6

Precipitation82.7 mm/mo 75.3–112

Air humidity59.4 % 57.6–64.2

Moisture balance-29.2 mm/mo -47.3–27.8

Vapour deficit600 Pa 420–819

Wind speed3.10 m/s 2.90–4.20

Cloud cover35.7 % 32.9–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)