Agalenatea redii

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Agalenatea

At a glance

Occurrence records20 209

Data sources9

Biological traits10

DNA specimens58

eDNA detections88

Sources9 archives

Databases and archives Agalenatea redii's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

World Spider Trait DBMasaryk University10 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources10 traits

Occurrence & distributionGBIF20 209 records

Environmental DNA2 datasets · 11 countries88 detections

DNA & barcodingBOLD58 specimens

01Narrative

Agalenatea redii is a species of 'orbweavers' belonging to the family Araneidae subfamily Araneinae.Invertebrate Ireland Online

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Pekár 2014aSimonneau et al. 2016Buchar & Růžička 2002SLU 2020Staręga et al. 2001Henriksen & Hilmo 2015Gajdoš et al. 2014Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Finch 2004Kielhorn 2017Vangsgård et al. 1996Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀8.45·♂5.4 mm

Predation1

Hunting guildorb web weavers

Ecology6

Ballooningyes

Circadian activitynocturnal

Light 2open

Moisture 2very dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryVulnerable (3)

Defence2

Primary defenceCamouflage

Retreatleaf

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agalenatea redii has left across the world's sequence archives.

At a glance

DNA specimens58

BINs2

Marker genes3

eDNA detections88

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

163Amostly conserved

190Gvariable

229Gmostly conserved

271Cvariable

340Tmostly conserved

401Tmostly conserved

433Amostly conserved

508Amostly conserved

514Gmostly conserved

529Cmostly conserved

539Cmostly conserved

559Gmostly conserved

625Gmostly conserved

AACATTATATTTAGTATTTGGTGCTTGAGCTGCTATAGTTGGTACGGCTATAAGAGTATTGATTCGAATTGAATTAGGTCAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes22

BINs2

Most divergent pair4.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona subfuscasame family10.4%Aculepeira armidasame family11.1%Neoscona pratensissame family11.4%Araneus ivieisame family11.6%Eriophora edaxsame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type20 209 records

Wild obs. + sensor19 235

Museum / vouchered941

Other33

Origin

Native94

Introduced120

Range

Area of Occupancy AOO43 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 6 020≤1 km 2 732≤10 km 4 953>10 km 508

14 213 georeferenced · 5 022 without coordinates

Open the mapobservation + sensor19 235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 155≤1 km 50≤10 km 429>10 km 14

648 georeferenced · 293 without coordinates

Open the institutions mapphysical evidence941

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UAclocation not on record	120
Brussels, BE	95
Frankfurt am Main	45
Copenhagen, DK	23
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	23
Adam Mickiewicz University in Poznańlocation not on record	18
	16
Ekaterinburg, RU	14
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	14
Departamento de Zoologia, Universidad de La Lagunalocation not on record	13
Akademia Pomorska w Słupskulocation not on record	10
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	10
Bonn, DE	10
FETSlocation not on record	8
SLU Artdatabankenlocation not on record	7
Helsinki, FI	6
European Distributed Institute of Taxonomy (EDIT)location not on record	6
Paro, BT	6
Tilburg, NL	6
Natural History Museum, Londonlocation not on record	4
South Kensington, GB	4
Tartu, EE	4
Prioksko-Terrasnyi Biosphere Reservelocation not on record	4
University of Tokyo, Department of Zoologylocation not on record	3
Washington, US	3
Geneva, CH	2
Uniwersytet w Białymstokulocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Liverpool, GB	2
ZSMlocation not on record	2
Zoologisches Museum Hamburglocation not on record	2
SNSDlocation not on record	1
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	1

33 institutions · 486 of 941 vouchered records shown · 450 without an institution code

09Environmental DNA88 detections

Where the DNA of Agalenatea redii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys2

Countries11

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map11 countries0

Regenmoor-ReliktflÃ¤cheWieseOlive orchardCity parks and large gardensDry calcareous grasslandDeciduous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 4.20–17.0

Seasonal swing summer↔winter17.5 °C

Max temp (day)16.8 °C 7.00–20.4

Min temp (night)6.20 °C 1.20–11.9

Precipitation50.9 mm/mo 37.9–98.4

Air humidity59.4 % 53.9–66.4

Moisture balance-24.9 mm/mo -86.7–10.4

Vapour deficit602 Pa 281–792

Wind speed3.80 m/s 1.80–5.60

Cloud cover41.4 % 36.0–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agalenatea redii

At a glance

Sources9 archives

Morphometry1

Predation1

Ecology6

Defence2

At a glance

Record type20 209 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 209 records