Aetomylaeus nichofii

(Bloch & Schneider, 1801) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Myliobatidae/Aetomylaeus

At a glance

Occurrence records293

Data sources12

Biological traits8

DNA specimens20

eDNA detections15

Sources12 archives

Databases and archives Aetomylaeus nichofii's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

OBISOcean Biodiversity Information System152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS293 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD20 specimens

Genome at a glanceGoaT · NCBI≈3.4 Gbp

01Narrative

The banded eagle ray (Aetomylaeus nichofii) is a species of fish in the family Myliobatidae. It is found in Australia, Bangladesh, Brunei, Cambodia, China, India, Indonesia, Japan, North Korea, South Korea, Malaysia, Myanmar, Pakistan, Papua New Guinea, the Philippines, Singapore, Sri Lanka, Taiwan, Thailand, Vietnam, possibly Maldives, and possibly Mozambique. Its natural habitats are open seas, shallow seas, and coral reefs. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length65 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max100 m

Depth min1 m

Vulnerability82.5

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetomylaeus nichofii has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 133 variable positions, in barcode order

2Cvariable

4Amostly conserved

8Cmostly conserved

10Amostly conserved

28Cmostly conserved

34Gmostly conserved

37Amostly conserved

40Cmostly conserved

49Tmostly conserved

53Cmostly conserved

55Amostly conserved

58Cmostly conserved

61Tmostly conserved

67Tmostly conserved

79Gvariable

85Amostly conserved

92Tmostly conserved

94Gmostly conserved

97Cmostly conserved

103Cmostly conserved

106Amostly conserved

109Tmostly conserved

118Amostly conserved

121Cmostly conserved

124Cmostly conserved

139Tmostly conserved

148Tmostly conserved

157Amostly conserved

160Tvariable

166Avariable

169Tmostly conserved

178Cvariable

181Gmostly conserved

187Cmostly conserved

194Cmostly conserved

199Cvariable

203Tmostly conserved

208Gmostly conserved

211Tmostly conserved

214Tvariable

232Cvariable

235Amostly conserved

244Tmostly conserved

247Tvariable

253Tmostly conserved

256Tvariable

259Gmostly conserved

265Cmostly conserved

271Amostly conserved

274Amostly conserved

277Cmostly conserved

280Tmostly conserved

283Tmostly conserved

284Tmostly conserved

286Amostly conserved

295Amostly conserved

298Amostly conserved

301Amostly conserved

310Tmostly conserved

313Gvariable

316Cvariable

322Tmostly conserved

325Tmostly conserved

334Cmostly conserved

337Cmostly conserved

344Cmostly conserved

346Amostly conserved

349Tvariable

352Tvariable

356Tvariable

361Cmostly conserved

364Cvariable

367Tmostly conserved

370Avariable

376Tmostly conserved

379Gmostly conserved

383Tmostly conserved

385Amostly conserved

388Cmostly conserved

397Cmostly conserved

398Tmostly conserved

403Cmostly conserved

404Cmostly conserved

409Amostly conserved

412Tmostly conserved

413Amostly conserved

414Tmostly conserved

415Cmostly conserved

418Tmostly conserved

421Cmostly conserved

424Cmostly conserved

425Cmostly conserved

430Amostly conserved

433Cvariable

439Tmostly conserved

445Tmostly conserved

457Tmostly conserved

460Tmostly conserved

463Gmostly conserved

472Cmostly conserved

478Tmostly conserved

481Tmostly conserved

487Cmostly conserved

490Amostly conserved

493Amostly conserved

505Amostly conserved

526Cmostly conserved

529Tmostly conserved

533Cmostly conserved

536Cvariable

538Amostly conserved

541Cmostly conserved

545Tmostly conserved

550Amostly conserved

553Tvariable

554Cmostly conserved

568Tmostly conserved

571Tmostly conserved

574Amostly conserved

604Tmostly conserved

+13 more variable positions not shown

CCTATACCTAATCTTTGGTGCATGAGCCGGGATGGTAGGCACTGGCCTTAGCCTACTCATTCGAACTGAACTAAGCCAGCCAGGAGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes6

BINs2

Most divergent pair18.6%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aetomylaeus caeruleofasciatussame genus4.3%Aetomylaeus maculatussame genus14.4%Aetomylaeus bovinussame genus15.5%Urolophus flavomosaicussame order15.6%Myliobatis californicasame family15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aetomylaeus nichofii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 426 298 508 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Aetomylaeus nichofii3.43 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type293 records

Wild obs. + sensor213

Museum / vouchered78

Other2

Origin

Native4

Range

Area of Occupancy AOO336 km²

Depth

0–200 m sunlit96

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 95 m · 96 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 182≤1 km 13>10 km 7

202 georeferenced · 11 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 7≤1 km 10≤10 km 8>10 km 6

31 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	7
Paris, FR	5
Zoologisches Museum Hamburglocation not on record	3
Los Angeles, US	3
Cambridge, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
Ann Arbor, US	1
CSIRO, Australian National Fish Collectionlocation not on record	1

9 institutions · 23 of 78 vouchered records shown · 6 without an institution code

09Environmental DNA15 detections

Where the DNA of Aetomylaeus nichofii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 22.5–32.8

Seasonal swing summer↔winter22.9 °C

Max temp (day)29.8 °C 25.9–40.2

Min temp (night)20.7 °C 18.8–24.5

Precipitation9.70 mm/mo 1.30–216

Air humidity42.0 % 35.4–68.0

Moisture balance-148 mm/mo

Vapour deficit1,841 Pa 1,027–3,204

Wind speed3.10 m/s

Cloud cover30.6 % 16.4–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)