Aetomylaeus caeruleofasciatus

White, Last & Baje, 2015 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Myliobatidae/Aetomylaeus

At a glance

Occurrence records225

Data sources8

Biological traits6

DNA specimens6

eDNA detections9

Sources8 archives

Databases and archives Aetomylaeus caeruleofasciatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

OBISOcean Biodiversity Information System160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS225 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD6 specimens

01Narrative

Aetomylaeus caeruleofasciatus is een vissensoort uit de familie van de adelaarsroggen (Myliobatidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2015 door White, Last & Baje. De soort komt voor in de noordelijke kustwateren van Australië en in de zuidelijke kustwateren van Nieuw-Guinea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length59.1 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Other traits3

Depth max117 m

Depth min10 m

Vulnerability82.5

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetomylaeus caeruleofasciatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes1

BIN1

Where individuals differ — all 20 variable positions, in barcode order

31Gvariable

178Tmostly conserved

469Amostly conserved

516Tmostly conserved

530Cvariable

533Cvariable

583Amostly conserved

584Gmostly conserved

585Amostly conserved

587Cmostly conserved

588Gmostly conserved

589Tmostly conserved

591Amostly conserved

593Cmostly conserved

594Tmostly conserved

595Cmostly conserved

597Amostly conserved

598Tmostly conserved

599Amostly conserved

600Cmostly conserved

CCTATACCTGATCTTTGGTGCATGAGCAGGGATAGTAGGCACTGGCCTTAGCCTACTCATTCGAACTGAACTAAGCCAACCAGGAGCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aetomylaeus nichofiisame genus4.3%Aetomylaeus maculatussame genus13.9%Aetomylaeus bovinussame genus13.9%Myliobatis californicasame family15.3%Myliobatis tenuicaudatussame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type225 records

Wild obs. + sensor110

Museum / vouchered115

Range

Area of Occupancy AOO288 km²

Depth

0–200 m sunlit95

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17.5 m · max 116.5 m · 95 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤1 km 70≤10 km 40

110 georeferenced

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 16≤1 km 24≤10 km 32

72 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DEWlocation not on record	15
Kanudi Fisheries Research Stationlocation not on record	10
Australian National Fish Collectionlocation not on record	9
PNG, CSIROlocation not on record	1

4 institutions · 35 of 115 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Aetomylaeus caeruleofasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.8–26.4

Seasonal swing summer↔winter3.60 °C

Max temp (day)27.1 °C 25.5–29.0

Min temp (night)23.8 °C 21.1–25.7

Precipitation187 mm/mo 0.6–369

Air humidity61.2 % 52.7–65.1

Vapour deficit1,194 Pa 1,187–1,470

Cloud cover39.5 % 17.9–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)