Aetomylaeus bovinus

(Geoffroy Saint-Hilaire, 1817) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Myliobatidae/Aetomylaeus

At a glance

Occurrence records1 807

Data sources11

Biological traits8

DNA specimens30

eDNA detections33

Sources11 archives

Databases and archives Aetomylaeus bovinus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility941 records↗

OBISOcean Biodiversity Information System866 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS1 807 records

Environmental DNA2 datasets · 6 countries33 detections

DNA & barcodingBOLD30 specimens

01Narrative

Aetomylaeus bovinus, also known as the bull ray, is a species of large stingray of the family Myliobatidae found around the coasts of Europe and Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body mass116 000 g

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max150 m

Depth min10 m

Vulnerability82.5

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aetomylaeus bovinus has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes3

eDNA detections33

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

53Tmostly conserved

56Tmostly conserved

80Gmostly conserved

89Cmostly conserved

95Cmostly conserved

197Amostly conserved

236Gmostly conserved

296Gmostly conserved

308Gvariable

329Tvariable

339Cmostly conserved

341Gmostly conserved

347Cmostly conserved

425Amostly conserved

446Gmostly conserved

485Gmostly conserved

506Gmostly conserved

584Tmostly conserved

593Cmostly conserved

596Amostly conserved

ACTTGATCTTTGGTGCATGAGCAGGTATAGTGGGCACTGGTCTTAGCTTACTTATTCGAACAGAATTAAGCCAACCTGGGGCTTTACTCG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes4

BINs2

Most divergent pair0.93%

AfricaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aetomylaeus maculatussame genus12.3%Aetomylaeus milvussame genus12.5%Aetomylaeus caeruleofasciatussame genus13.9%Myliobatis peruvianussame family14.1%Myliobatis ridenssame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S-ND212S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type1 807 records

Wild obs. + sensor1 696

Museum / vouchered103

Other8

Origin

Native2

Range

Area of Occupancy AOO1 448 km²

Depth

0–200 m sunlit59

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 85 m · 59 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 43≤1 km 8≤10 km 4>10 km 73

128 georeferenced · 1 568 without coordinates

Open the mapobservation + sensor1 696

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 11≤1 km 2≤10 km 4

17 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	5
Museu Nacional de História Natural e da Ciêncialocation not on record	3
RBINS-Scientific Heritagelocation not on record	1
Brussels, BE	1
FishBaselocation not on record	1
ICM-CSIClocation not on record	1

6 institutions · 12 of 103 vouchered records shown · 18 without an institution code

09Environmental DNA33 detections

Where the DNA of Aetomylaeus bovinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map6 countries0

MarineSandSeagrassNo vegetationno informationSandy Bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 12.5–23.0

Seasonal swing summer↔winter8.00 °C

Max temp (day)24.2 °C 16.1–26.2

Min temp (night)18.0 °C 7.20–19.9

Precipitation42.3 mm/mo 0.6–113

Air humidity56.9 % 46.2–62.7

Moisture balance25.6 mm/mo

Vapour deficit1,099 Pa 709–1,340

Wind speed5.90 m/s

Cloud cover25.3 % 19.9–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aetomylaeus bovinus

At a glance

Sources11 archives

Size & morphology1

Habitat & environment3

Uses & economy1

Other traits3

At a glance

Record type1 807 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 807 records