Aethes rutilana

(Hübner, 1814-1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records1 851

Data sources8

Biological traits2

DNA specimens51

eDNA detections62

Sources8 archives

Databases and archives Aethes rutilana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 851 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 851 records

Environmental DNA3 datasets · 11 countries62 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT · NCBI≈420 Mbp

01Narrative

Aethes rutilana, the pale juniper webworm, is a moth of the family Tortricidae. It was described by Jacob Hübner in 1817. It is found in the whole of Europe and North America. The wingspan is 10 –. The larvae feed on Juniperus communis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes rutilana has left across the world's sequence archives.

At a glance

DNA specimens51

BINs1

Marker genes1

eDNA detections62

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

4Amostly conserved

58Amostly conserved

67Amostly conserved

68Gmostly conserved

76Avariable

106Cmostly conserved

133Tmostly conserved

145Tmostly conserved

196Amostly conserved

200Gmostly conserved

202Cmostly conserved

226Tvariable

401Cmostly conserved

470Amostly conserved

483Avariable

490Cmostly conserved

511Amostly conserved

527Gmostly conserved

544Amostly conserved

550Amostly conserved

574Tmostly conserved

583Amostly conserved

625Tvariable

649Avariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes16

BIN1

Most divergent pair2.6%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes beatricellasame genus7.6%Gynnidomorpha luridanasame family7.6%Aethes francillanasame genus7.8%Aethes tesseranasame genus7.9%Phalonidia basiochreanasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aethes rutilana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈420 310 828 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aethes rutilana0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

08Occurrence & distribution

Record type1 851 records

Wild obs. + sensor1 479

Museum / vouchered364

Other8

Range

Area of Occupancy AOO3 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 682≤1 km 375≤10 km 360>10 km 6

1 423 georeferenced · 56 without coordinates

Open the mapobservation + sensor1 479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 100≤1 km 102≤10 km 44

246 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence364

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	65
NHMOlocation not on record	60
Provincia di Livornolocation not on record	34
Tartu, EE	30
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	27
Nijmegen, NL	22
SLU Artdatabankenlocation not on record	22
Tallinn, EE	11
NTNU-VMlocation not on record	6
Rovaniemi, FI	6
Stockholm, SE	6
Cornell University Insect Collectionlocation not on record	6
Kuopio, FI	5
South Kensington, GB	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Philadelphia, US	2
New Haven, US	2
St. Paul, US	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
ZSMlocation not on record	1
Iwate Prefectural Museumlocation not on record	1
East Lansing, US	1
Research Collection of Hartmut Wegnerlocation not on record	1
neflocation not on record	1

24 institutions · 320 of 364 vouchered records shown · 44 without an institution code

09Environmental DNA62 detections

Where the DNA of Aethes rutilana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys3

Countries11

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map11 countries0

Alpine willow zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 5.50–18.5

Seasonal swing summer↔winter20.3 °C

Max temp (day)18.1 °C 8.40–23.6

Min temp (night)10.0 °C 2.40–15.1

Precipitation83.2 mm/mo 55.7–158

Air humidity60.7 % 56.2–65.1

Moisture balance-7.70 mm/mo -86.3–57.6

Vapour deficit698 Pa 371–909

Wind speed3.20 m/s 1.80–5.10

Cloud cover41.3 % 35.1–60.1

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aethes rutilana

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 851 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 851 records