Aenetus mirabilis

(Rothschild, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records33

Data sources6

Biological traits0

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Aenetus mirabilis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Aenetus mirabilis is a moth of the family Hepialidae. It is known from Queensland.Australian Faunal Directory The wingspan is about 100 mm. Adult males have blue-green forewings and white hindwings. They have a set of brown hairs at the base of the wings that emit a pheromone. Females have brownish-green forewings and yellow hindwings. The larvae feed on Alphitonia species. They bore in the stems of trees and saplings.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus mirabilis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

130Avariable

412Cmostly conserved

469Cvariable

625Gvariable

AACTTTATATTTTATTTTTGGAATCTGATCAGGTATGGTTGGAACATCATTAAGATTATTAATTCGAACAGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aenetus dulcissame genus6.5%Aenetus scottisame genus6.8%Aenetus blackburniisame genus7.3%Aenetus scriptasame genus7.4%Aenetus ombralomasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor23

Museum / vouchered10

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 14≤1 km 4>10 km 3

21 georeferenced · 2 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 2>10 km 1

5 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	2
ZSMlocation not on record	1

3 institutions · 7 of 10 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Aenetus mirabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 23.2–26.1

Seasonal swing summer↔winter6.10 °C

Max temp (day)26.4 °C 25.8–27.1

Min temp (night)23.2 °C 20.4–25.2

Precipitation147 mm/mo 103–229

Air humidity63.1 % 62.2–68.8

Vapour deficit1,172 Pa 903–1,236

Cloud cover42.6 % 31.6–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)