Aenetus ombraloma

(Lower, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records99

Data sources5

Biological traits0

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Aenetus ombraloma's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility99 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF99 records

DNA & barcodingBOLD5 specimens

01Narrative

Aenetus ombraloma is a moth of the family Hepialidae. It is known from Tasmania.Australian Faunal Directory The wingspan is about 60 mm. The larvae feed on Eucalyptus obliqua, Eucalyptus regnans and Eucalyptus johnstonii. They bore in the stem of their host plant. They cover the entrance to their tunnel with a web of silk. Pupation takes place inside the tunnel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus ombraloma has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.62%

Haplotypes1

BIN1

Where individuals differ — all 7 variable positions, in barcode order

46Amostly conserved

85Cvariable

343Cvariable

346Tvariable

379Cmostly conserved

388Gvariable

565Tvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCTTTAAGATTACTAATCCGAACAGAATTAGGTAATCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aenetus scottisame genus4.4%Aenetus dulcissame genus5.9%Aenetus scriptasame genus6.1%Aenetus blackburniisame genus6.5%Aenetus astathessame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor7

Museum / vouchered92

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 2

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 2≤1 km 52≤10 km 14>10 km 17

85 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	76
Museums Victorialocation not on record	6
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	6

3 institutions · 88 of 92 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)