Aenetus dulcis

(Swinhoe, 1892) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records117

Data sources6

Biological traits0

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Aenetus dulcis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Aenetus dulcis is a moth of the family Hepialidae first described by Charles Swinhoe in 1892. It is known from Western Australia. The wingspan is about 110 mm. Adult males are pale green. Females have green forewings with two white stripes. The hindwings are orange. The larvae feed on Agonis flexuosa.Australian Faunal Directory They bore in the stem of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus dulcis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes2

BINs2

Most divergent pair1.8%

Where individuals differ — all 13 variable positions, in barcode order

82Tmostly conserved

85Amostly conserved

118Tmostly conserved

127Gvariable

235Cmostly conserved

274Cmostly conserved

322Tmostly conserved

352Cmostly conserved

407Tmostly conserved

505Cmostly conserved

553Tmostly conserved

562Amostly conserved

646Cvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCTTTAAGATTACTAATTCGAACAGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aenetus scriptasame genus2.7%Aenetus scottisame genus3.8%Aenetus ramsayisame genus5.9%Aenetus ombralomasame genus5.9%Aenetus astathessame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type117 records

Wild obs. + sensor110

Museum / vouchered7

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 54≤1 km 13≤10 km 11>10 km 6

84 georeferenced · 26 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	2
Natick, US	1
Sydney, AU	1

3 institutions · 4 of 7 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Aenetus dulcis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 16.7–21.6

Seasonal swing summer↔winter9.20 °C

Max temp (day)23.6 °C 20.9–27.8

Min temp (night)15.0 °C 12.0–16.8

Precipitation31.1 mm/mo 20.2–49.2

Air humidity56.6 % 52.6–58.4

Moisture balance-68.0 mm/mo

Vapour deficit945 Pa 797–1,241

Wind speed3.20 m/s

Cloud cover18.8 % 13.6–21.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)