Aenetus ramsayi

(Scott, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Aenetus

At a glance

Occurrence records61

Data sources6

Biological traits0

DNA specimens5

eDNA detections4

Sources6 archives

Databases and archives Aenetus ramsayi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Aenetus ramsayi, the swift ghost moth, is a moth of the family Hepialidae. It is known from Queensland and New South Wales.Australian Faunal Directory The wingspan is 100 mm for females and 80 mm for males. Adults are on wing from February to March. The larvae feed on various trees and saplings, including Diploglottis australis, Alectryon, Syzygium smithii and Eucalyptus grandis. They bore in the stem of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aenetus ramsayi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.68%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

199Avariable

256Tvariable

322Tvariable

383Tvariable

394Tvariable

475Tvariable

TGGAATTTGATCAGGTATAGTTGGAACATCTCTAAGATTATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGGGATGACCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aenetus scottisame genus4.7%Aenetus scriptasame genus5.5%Aenetus dulcissame genus5.9%Aenetus blackburniisame genus6.2%Aenetus astathessame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor47

Museum / vouchered14

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 22≤1 km 8≤10 km 5>10 km 7

42 georeferenced · 5 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 4≤10 km 5>10 km 1

10 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	5
Sydney, AU	4
Australian National Insect Collectionlocation not on record	2
Cambridge, US	1

4 institutions · 12 of 14 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Aenetus ramsayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 20.9–22.9

Seasonal swing summer↔winter10.8 °C

Max temp (day)27.0 °C 25.2–27.0

Min temp (night)19.0 °C 16.8–19.0

Precipitation96.2 mm/mo 91.7–96.2

Air humidity61.6 % 60.8–61.6

Moisture balance-29.8 mm/mo -29.8–-9.80

Vapour deficit1,065 Pa 963–1,065

Wind speed2.30 m/s 2.20–2.30

Cloud cover28.1 % 25.2–28.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)