Aedes triseriatus

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records20 244

Data sources10

Biological traits0

DNA specimens381

eDNA detections4

Sources10 archives

Databases and archives Aedes triseriatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics381 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF20 244 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD381 specimens

Genome at a glanceGoaT · TreeOfSex1.5 Gbp

01Narrative

Ochlerotatus triseriatus, also known by the synonym Aedes triseriatus, is a member of the true fly order (Diptera: Culicidae). It is called the eastern tree hole mosquito due to its predilection towards breeding in stagnant water that is found in natural holding containers such as tree holes. It is native to the eastern United States and southern Canada and favors hardwood habitats. It has been found as far south as the Florida Keys, as far west as Idaho and Utah, and as far north as Quebec and Ontario. This species has not yet been found in Europe, but it has the potential to spread through international trade. In 2004, it was found in a shipment of tires travelling from Louisiana to France, but it was identified and targeted with insecticides that truncated its spread. It is a known vector of La Crosse encephalitis and canine heartworm disease. In the laboratory, it has been found to vector several other viruses including yellow fever, eastern encephalitis, Venezuelan encephalitis, and western encephalitis. Because of its potential for international spread and its proclivity for transmitting disease, monitoring the distribution of this species is essential.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding381 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes triseriatus has left across the world's sequence archives.

At a glance

DNA specimens381

BINs2

Marker genes2

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus315 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

23Amostly conserved

40Gmostly conserved

166Amostly conserved

208Gvariable

235Cvariable

238Cvariable

271Tvariable

304Gvariable

316Gmostly conserved

322Amostly conserved

343Cmostly conserved

346Cvariable

364Cmostly conserved

370Tvariable

412Avariable

415Amostly conserved

433Amostly conserved

472Amostly conserved

490Tvariable

496Amostly conserved

610Cvariable

631Amostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTGGGTACATCATTAAGAATTTTAGTTCGTGCCGAACTAAGCCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 32 commonest of 109 variants.

Diversity (π)1.3%

Haplotypes109

BIN1

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes ventrovittissame genus7.4%Aedes infirmatussame genus8.2%Aedes procaxsame genus8.6%Aedes berlandisame genus8.7%Aedes dorsalissame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aedes triseriatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 486 560 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes triseriatus1.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 65×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Animal Genome Size Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Animal Genome Size Database — ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

07Deep time~52.6 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin52.6 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type20 244 records

Wild obs. + sensor17 967

Museum / vouchered2 277

Origin

Native1

Range

Area of Occupancy AOO6 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 317≤1 km 90≤10 km 25>10 km 90

522 georeferenced · 17 445 without coordinates

Open the mapobservation + sensor17 967

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 1 187≤1 km 25≤10 km 120>10 km 66

1 398 georeferenced · 879 without coordinates

Open the institutions mapphysical evidence2 277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 174
Mosquitolocation not on record	586
Saint John, CA	97
Champaign, US	64
National Ecological Observatory Network, United Stateslocation not on record	55
San Francisco, US	51
Wuzhou, CN	36
UNHClocation not on record	33
East Lansing, US	31
New Haven, US	30
Cambridge, US	27
Chicago, US	23
Ann Arbor, US	19
Ciudad de México, MX	18
CUlocation not on record	7
San Nicolás de los Garza, MX	4
St. Paul, US	3
WIlocation not on record	3
University of Central Floridalocation not on record	1
Edmonton, CA	1
Blacksburg, US	1
Los Angeles, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Vancouver, CA	1
University of Guelphlocation not on record	1
NEON Biorepository at Arizona State Universitylocation not on record	1
Natural History Museum of Utahlocation not on record	1

27 institutions · 2 270 of 2 277 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Aedes triseriatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

evergreenForestdeciduousForestwoodyWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 14.3–21.6

Seasonal swing summer↔winter26.8 °C

Max temp (day)25.2 °C 20.2–26.8

Min temp (night)15.2 °C 10.0–17.0

Precipitation109 mm/mo 88.0–117

Air humidity57.4 % 56.7–57.6

Moisture balance-23.8 mm/mo -45.7–-2.20

Vapour deficit995 Pa 802–1,110

Wind speed3.30 m/s 2.90–5.10

Cloud cover36.8 % 32.2–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes triseriatus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type20 244 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 244 records