Aedes tremulus

(Theobald, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records459

Data sources4

Biological traits0

DNA specimens16

eDNA detections13

Sources4 archives

Databases and archives Aedes tremulus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility459 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF459 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD16 specimens

01Narrative

Macleaya tremula is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1903 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes tremulus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes2

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

59Cvariable

74Cmostly conserved

82Tvariable

85Tvariable

88Avariable

139Tmostly conserved

217Tvariable

220Cvariable

223Amostly conserved

226Tmostly conserved

229Amostly conserved

235Cvariable

271Cvariable

283Cvariable

284Tvariable

356Gmostly conserved

361Tmostly conserved

376Tmostly conserved

400Cmostly conserved

412Tmostly conserved

415Amostly conserved

445Cmostly conserved

448Tmostly conserved

475Avariable

490Tmostly conserved

493Amostly conserved

499Tvariable

506Gmostly conserved

529Avariable

578Tmostly conserved

581Cmostly conserved

589Tvariable

592Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTCGGAGTTTGATCTGGAATAATTGGTACATCAATAAGTGTTCTAATTCGTACTGAACTAAGTCATCCTGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes3

BINs3

Most divergent pair2.4%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes dorsalissame genus9.3%Aedes atlanticussame genus9.4%Aedes melanimonsame genus9.6%Aedes nigrithoraxsame genus9.6%Aedes phoeniciaesame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type459 records

Wild obs. + sensor28

Museum / vouchered431

Range

Area of Occupancy AOO468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 22>10 km 6

28 georeferenced

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 1

5 georeferenced · 426 without coordinates

Open the institutions mapphysical evidence431

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	219
Natick, US	202
Australian National Fish Collectionlocation not on record	4
Sydney, AU	2

4 institutions · 427 of 431 vouchered records shown · 4 without an institution code

09Environmental DNA13 detections

Where the DNA of Aedes tremulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 21.5–27.5

Seasonal swing summer↔winter15.3 °C

Max temp (day)31.2 °C 27.4–31.5

Min temp (night)18.4 °C 15.7–24.9

Precipitation36.8 mm/mo 17.0–290

Air humidity45.6 % 42.9–62.1

Moisture balance-146 mm/mo -155–129

Vapour deficit1,706 Pa 1,336–1,788

Wind speed3.90 m/s 2.80–4.50

Cloud cover21.0 % 16.6–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)