Aedes scapularis

Rondani, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 099

Data sources6

Biological traits0

DNA specimens315

eDNA detections328

Sources6 archives

Databases and archives Aedes scapularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 099 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI328 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics315 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 099 records

Environmental DNA1 datasets · 10 countries328 detections

DNA & barcodingBOLD315 specimens

01Narrative

Aedes scapularis is a species of mosquito primarily found in neo-tropical regions of the Americas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding315 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes scapularis has left across the world's sequence archives.

At a glance

DNA specimens315

BINs1

Marker genes3

eDNA detections328

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus286 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

100Gmostly conserved

136Cmostly conserved

181Amostly conserved

184Amostly conserved

271Tmostly conserved

280Gmostly conserved

304Gmostly conserved

316Amostly conserved

358Gvariable

364Tmostly conserved

373Amostly conserved

412Cmostly conserved

415Gmostly conserved

433Amostly conserved

436Cmostly conserved

565Amostly conserved

577Amostly conserved

613Cmostly conserved

625Amostly conserved

628Amostly conserved

AACATTATACTTCATTTTTGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCACCCAGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes28

BIN1

Most divergent pair2.0%

S.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes euplocamussame genus2.3%Aedes infirmatussame genus7.0%Aedes condolescenssame genus7.2%Aedes angustivittatussame genus7.5%Aedes trivittatussame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type1 099 records

Wild obs. + sensor112

Museum / vouchered987

Range

Area of Occupancy AOO1 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 42≤1 km 22≤10 km 10>10 km 10

84 georeferenced · 28 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 309≤1 km 2≤10 km 12>10 km 1

324 georeferenced · 663 without coordinates

Open the institutions mapphysical evidence987

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	486
Ciudad de México, MX	293
UFPRlocation not on record	98
Fundação Oswaldo Cruzlocation not on record	37
San Nicolás de los Garza, MX	28
EcoFoGlocation not on record	12
UMR Ecologie des Forets de Guyanelocation not on record	7
New Haven, US	6
The University of the West Indies, Trinidad and Tobagolocation not on record	6
University of Queensland Insect Collectionlocation not on record	3
Ann Arbor, US	3
Universidad Nacional de Cordoba, Centro de Investigaciones Entomologicas de Cordobalocation not on record	2
Institut Pasteur de la Guyanelocation not on record	2
Bernardino Rivadavia Natural Sciences Museumlocation not on record	1
Universidad Autonoma Agraria Antonio Narro, Unidad Lagunalocation not on record	1
Wuzhou, CN	1
UNHClocation not on record	1

17 institutions · 987 of 987 vouchered records shown

09Environmental DNA328 detections

Where the DNA of Aedes scapularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found328

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 328 detections have coordinates

Open the map10 countries0

Urban greenSecondary forest1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 21.9–26.0

Seasonal swing summer↔winter14.2 °C

Max temp (day)28.9 °C 26.6–30.2

Min temp (night)21.1 °C 18.7–22.2

Precipitation154 mm/mo 113–171

Air humidity60.2 % 55.9–64.7

Moisture balance-13.9 mm/mo -73.9–42.9

Vapour deficit1,154 Pa 1,008–1,433

Wind speed3.40 m/s 1.10–4.10

Cloud cover38.8 % 32.4–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 319 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes scapularis

At a glance

Sources6 archives

At a glance

Record type1 099 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 099 records