Aedes nipponicus

LaCasse & Yamaguti, 1948 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records4

Data sources5

Biological traits0

DNA specimens18

eDNA detections18

Sources5 archives

Databases and archives Aedes nipponicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Downsiomyia nipponica is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1948 door LaCasse & Yamaguti.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes nipponicus has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes2

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

1Avariable

43Avariable

70Tmostly conserved

79Cvariable

89Gmostly conserved

106Cvariable

166Avariable

187Cvariable

220Cvariable

271Tvariable

278Cvariable

284Tmostly conserved

287Tmostly conserved

295Avariable

298Tmostly conserved

316Avariable

322Gvariable

325Tvariable

343Cvariable

347Tvariable

361Cvariable

364Gmostly conserved

385Cvariable

412Cmostly conserved

415Avariable

418Amostly conserved

421Amostly conserved

457Tvariable

463Tvariable

514Tvariable

530Avariable

532Cvariable

550Avariable

565Avariable

581Cvariable

595Cvariable

628Amostly conserved

631Avariable

634Cmostly conserved

640Tmostly conserved

646Cvariable

657Tmostly conserved

AACATTATATTTTATTTTTGGAGTTTGATCTGGAATAATTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGCCAACCAGGAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes9

BINs2

Most divergent pair5.0%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes ventrovittissame genus8.8%Aedes caballussame genus9.1%Aedes ripariussame genus9.1%Aedes clelandisame genus9.1%Aedes aurifersame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor1

Museum / vouchered3

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	1
KOMlocation not on record	1

2 institutions · 2 of 3 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Aedes nipponicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 7.80–15.3

Seasonal swing summer↔winter23.9 °C

Max temp (day)15.6 °C 10.1–16.8

Min temp (night)8.30 °C 3.60–13.7

Precipitation138 mm/mo 112–306

Air humidity59.3 % 58.0–64.9

Moisture balance252 mm/mo

Vapour deficit690 Pa 434–727

Wind speed3.80 m/s

Cloud cover44.3 % 37.7–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)