Aedes fulvus

(Wiedemann, 1828) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records466

Data sources5

Biological traits0

DNA specimens97

eDNA detections92

Sources5 archives

Databases and archives Aedes fulvus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility466 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF466 records

Environmental DNA1 datasets · 3 countries92 detections

DNA & barcodingBOLD97 specimens

01Narrative

Ochlerotatus fulvus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1828 door Wiedemann.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes fulvus has left across the world's sequence archives.

At a glance

DNA specimens97

BINs3

Marker genes1

eDNA detections92

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus89 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

4Amostly conserved

5Cmostly conserved

79Cmostly conserved

88Gvariable

115Tmostly conserved

202Cmostly conserved

206Cmostly conserved

220Tmostly conserved

266Tmostly conserved

271Cmostly conserved

278Cmostly conserved

292Cmostly conserved

316Gvariable

340Tmostly conserved

352Gmostly conserved

358Tmostly conserved

370Cmostly conserved

494Tmostly conserved

529Cmostly conserved

532Amostly conserved

547Amostly conserved

565Amostly conserved

589Tmostly conserved

596Tmostly conserved

628Gvariable

640Cmostly conserved

646Cmostly conserved

AACACTATATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGCCAACCAGGGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 56 variants.

Diversity (π)1.4%

Haplotypes56

BINs3

Most divergent pair12.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes tortilissame genus6.8%Aedes dorsalissame genus7.0%Aedes angustivittatussame genus7.1%Aedes caspiussame genus7.1%Aedes caballussame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type466 records

Wild obs. + sensor335

Museum / vouchered131

Range

Area of Occupancy AOO572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 3≤1 km 3≤10 km 1>10 km 4

11 georeferenced · 324 without coordinates

Open the mapobservation + sensor335

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 43≤1 km 4≤10 km 13

60 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad de México, MX	42
Washington, US	42
UFPRlocation not on record	7
Wuzhou, CN	6
San Francisco, US	6
Institut Pasteur de la Guyanelocation not on record	6
EcoFoGlocation not on record	6
The University of the West Indies, Trinidad and Tobagolocation not on record	5
UNHClocation not on record	4
Fundação Oswaldo Cruzlocation not on record	2
Champaign, US	2
University of Queensland Insect Collectionlocation not on record	1
San Nicolás de los Garza, MX	1
Chicago, US	1

14 institutions · 131 of 131 vouchered records shown

09Environmental DNA92 detections

Where the DNA of Aedes fulvus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map3 countries0

mixedForestdeciduousForestwoodyWetlandsevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 18.5–27.5

Seasonal swing summer↔winter18.5 °C

Max temp (day)31.4 °C 24.4–32.7

Min temp (night)22.2 °C 14.2–23.4

Precipitation118 mm/mo 83.9–183

Air humidity60.1 % 56.9–64.3

Moisture balance-14.4 mm/mo -49.9–34.8

Vapour deficit1,272 Pa 962–1,432

Wind speed2.30 m/s 1.50–2.90

Cloud cover31.7 % 26.1–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)