Aedes fluviatilis

(Lutz, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records453

Data sources4

Biological traits0

DNA specimens86

eDNA detections17

Sources4 archives

Databases and archives Aedes fluviatilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics86 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF453 records

Environmental DNA1 datasets · 4 countries17 detections

DNA & barcodingBOLD86 specimens

01Narrative

Georgecraigius fluviatilis is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Lutz.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding86 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes fluviatilis has left across the world's sequence archives.

At a glance

DNA specimens86

BINs1

Marker genes2

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

22Amostly conserved

100Gmostly conserved

106Cmostly conserved

166Gvariable

181Avariable

238Cvariable

271Tvariable

274Tmostly conserved

280Amostly conserved

286Amostly conserved

340Tvariable

343Cmostly conserved

373Amostly conserved

421Gvariable

433Amostly conserved

508Amostly conserved

520Cvariable

544Gvariable

547Amostly conserved

548Tvariable

550Gvariable

556Amostly conserved

577Amostly conserved

578Tvariable

589Cmostly conserved

607Tvariable

628Amostly conserved

634Tvariable

646Cmostly conserved

AACATTATATTTTATTTTTGGAGTTTGATCAGGAATAATTGGAACCTCATTAAGAATTTTAATTCGAGCAGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BIN1

Most divergent pair3.0%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes saxicolasame genus3.6%Aedes ventrovittissame genus10.3%Aedes cantatorsame genus10.5%Aedes vittigersame genus10.8%Aedes nigrithoraxsame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type453 records

Wild obs. + sensor5

Museum / vouchered448

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 446 without coordinates

Open the institutions mapphysical evidence448

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	303
EcoFoGlocation not on record	62
Institut Pasteur de la Guyanelocation not on record	58
Instituto Nacional de Biodiversidad (INBio)location not on record	9
UMR Ecologie des Forets de Guyanelocation not on record	6
Fundação Oswaldo Cruzlocation not on record	5
UFPRlocation not on record	3
Universidad de Antioquia (UdeA)location not on record	1
San Nicolás de los Garza, MX	1

9 institutions · 448 of 448 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Aedes fluviatilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

Anthropized

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 19.2–26.1

Seasonal swing summer↔winter5.40 °C

Max temp (day)28.7 °C 23.7–30.7

Min temp (night)21.4 °C 13.9–22.3

Precipitation449 mm/mo 38.2–552

Air humidity65.3 % 59.1–68.8

Moisture balance292 mm/mo -68.2–395

Vapour deficit988 Pa 899–1,219

Wind speed0.9 m/s 0.7–2.50

Cloud cover28.4 % 23.6–35.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)