Aedes alternans

(Westwood, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records470

Data sources6

Biological traits0

DNA specimens27

eDNA detections23

Sources6 archives

Databases and archives Aedes alternans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF470 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD27 specimens

01Narrative

Mucidus alternans is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1835 door Westwood.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes alternans has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes2

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

40Amostly conserved

43Gvariable

58Cvariable

100Amostly conserved

154Tmostly conserved

166Gvariable

181Amostly conserved

190Amostly conserved

197Tmostly conserved

212Tvariable

214Amostly conserved

253Avariable

271Tmostly conserved

298Tmostly conserved

328Amostly conserved

343Cmostly conserved

373Amostly conserved

412Gmostly conserved

433Gmostly conserved

496Amostly conserved

508Amostly conserved

562Tmostly conserved

628Gmostly conserved

634Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGGACATCATTAAGTGTCTTAATTCGAGCAGAGTTAAGTCAACCTAGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes7

BIN1

Most divergent pair1.8%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes sudanensissame genus8.4%Aedes pertinaxsame genus10.2%Aedes atlanticussame genus10.2%Aedes dentatussame genus10.7%Aedes serratussame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_054325 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1large subunit ribosomal RNAsmall subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type470 records

Wild obs. + sensor275

Museum / vouchered195

Range

Area of Occupancy AOO1 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 149≤1 km 36≤10 km 11>10 km 29

225 georeferenced · 50 without coordinates

Open the mapobservation + sensor275

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 4≤10 km 16>10 km 3

23 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	81
Natick, US	80
Sydney, AU	18
Museums Victorialocation not on record	8
Australian National Fish Collectionlocation not on record	4
San Francisco, US	1
DPIlocation not on record	1

7 institutions · 193 of 195 vouchered records shown · 2 without an institution code

09Environmental DNA23 detections

Where the DNA of Aedes alternans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 18.0–27.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)28.1 °C 20.7–32.7

Min temp (night)17.4 °C 15.7–23.7

Precipitation68.3 mm/mo 18.7–115

Air humidity56.5 % 47.6–61.1

Moisture balance-89.3 mm/mo -183–15.6

Vapour deficit1,256 Pa 868–1,781

Wind speed3.30 m/s 2.50–4.40

Cloud cover26.4 % 17.6–33.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)