Adoxophyes privatana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Adoxophyes

At a glance

Occurrence records283

Data sources8

Biological traits0

DNA specimens8

eDNA detections1

Sources8 archives

Databases and archives Adoxophyes privatana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility283 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF283 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD8 specimens

01Narrative

Adoxophyes privatana, the appleleaf-curling moth, is a moth of the family Tortricidae. The species was first described by Francis Walker in 1863. It is native to south-east Asia, where it has been recorded from Taiwan, Hong Kong, Hainan in China, Nepal, India, Sri-Lanka, Thailand, Vietnam, western Malaysia, Singapore, Sumatra, Java, Borneo, the Philippines and the Chagos Archipelago. It is an accidental introduction in Great Britain.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoxophyes privatana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

1Tvariable

19Tmostly conserved

59Cmostly conserved

79Tmostly conserved

94Amostly conserved

106Cmostly conserved

118Cvariable

154Tmostly conserved

163Avariable

169Tmostly conserved

181Amostly conserved

187Tmostly conserved

202Tvariable

205Tmostly conserved

262Amostly conserved

265Amostly conserved

271Tvariable

274Tmostly conserved

280Cvariable

304Cvariable

337Tmostly conserved

340Tmostly conserved

364Cvariable

370Tmostly conserved

397Tmostly conserved

400Avariable

427Tmostly conserved

433Amostly conserved

448Cvariable

463Tmostly conserved

466Amostly conserved

469Avariable

472Cvariable

481Avariable

484Amostly conserved

485Tmostly conserved

490Tmostly conserved

514Cvariable

526Amostly conserved

536Tmostly conserved

547Tvariable

565Avariable

578Cmostly conserved

604Cvariable

613Tmostly conserved

616Cvariable

634Cvariable

646Tvariable

653Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGTACATCTTTAAGTTTACTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes5

BINs3

Most divergent pair4.6%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes honmaisame genus2.6%Adoxophyes dubiasame genus2.6%Adoxophyes cyrtosemasame genus3.3%Adoxophyes oranasame genus6.8%Argyrotaenia burnsorumsame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type283 records

Wild obs. + sensor282

Museum / vouchered1

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 120≤1 km 77≤10 km 24>10 km 14

235 georeferenced · 47 without coordinates

Open the mapobservation + sensor282

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Provincia di Foggialocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Adoxophyes privatana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)