Adoxophyes dubia

Yasuda, 1998 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Adoxophyes

At a glance

Occurrence records6

Data sources6

Biological traits0

DNA specimens15

eDNA detections1

Sources6 archives

Databases and archives Adoxophyes dubia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD15 specimens

01Narrative

Adoxophyes dubia is a species of moth of the family Tortricidae. It is found in Japan, where it has been recorded from southern Honshu, Shikoku, Kyushu and Okinawa. The length of the forewings is 8 mm for males and 9 mm for females. The forewings of the males are pale ochreous with bright brown markings. The hindwings are pale greyish-ochreous, becoming yellowish towards the apex. Females have light ochreous-yellow forewings and glossy greyish-ochreous hindwings. The larvae feed on Lyonia and Ribes species., 1998: The Japanese species of the genus Adoxophyes Meyrick (Lepidoptera, Tortricidae). Transactions of the Lepidopterological Society of Japan 49(3): 159-173. Abstract and full article: [1].

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoxophyes dubia has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

154Amostly conserved

TTTTATTTTTGGAATTTGAGCAGGAATAATTGGTACATCTTTAAGTTTACTAATTCGAGCTGAATTAGGTAATCCTGGTTCATTATTAGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes fasciculanasame genus1.7%Adoxophyes privatanasame genus2.6%Adoxophyes cyrtosemasame genus3.7%Adoxophyes oranasame genus6.4%Lobesia aeolopasame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor2

Museum / vouchered4

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	4

1 institutions · 4 of 4 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Adoxophyes dubia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)