Adoxophyes cyrtosema

Meyrick, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Adoxophyes

At a glance

Occurrence records15

Data sources8

Biological traits0

DNA specimens17

eDNA detections1

Sources8 archives

Databases and archives Adoxophyes cyrtosema's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD17 specimens

01Narrative

Adoxophyes cyrtosema is a species of moth of the family Tortricidae. It is found in Tonga, on the New Hebrides and in China (Guangzhou, Fujian). The larvae have been recorded feeding on litchi and longan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoxophyes cyrtosema has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

5Tmostly conserved

19Cmostly conserved

38Amostly conserved

59Cmostly conserved

106Cmostly conserved

118Tmostly conserved

154Cmostly conserved

163Tmostly conserved

166Amostly conserved

169Cvariable

181Amostly conserved

202Tmostly conserved

205Cmostly conserved

235Cmostly conserved

265Amostly conserved

271Amostly conserved

286Amostly conserved

355Tmostly conserved

364Cmostly conserved

397Cmostly conserved

400Cmostly conserved

433Amostly conserved

469Amostly conserved

484Amostly conserved

536Tmostly conserved

544Tmostly conserved

547Amostly conserved

550Amostly conserved

604Tmostly conserved

613Cmostly conserved

616Cmostly conserved

625Amostly conserved

628Amostly conserved

634Tmostly conserved

637Tmostly conserved

640Tmostly conserved

643Tvariable

646Cmostly conserved

653Cmostly conserved

TACATTATATTTTATTTTCGGAATTTGAGCAGGAATAATTGGTACATCTTTAAGTTTACTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes13

BINs2

Most divergent pair1.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes fasciculanasame genus3.0%Adoxophyes privatanasame genus3.3%Adoxophyes honmaisame genus3.6%Adoxophyes dubiasame genus3.7%Adoxophyes oranasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor1

Museum / vouchered14

Origin

Native14

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SUVlocation not on record	14

1 institutions · 14 of 14 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Adoxophyes cyrtosema was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)