Adoxophyes furcatana

(Walker, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Adoxophyes

At a glance

Occurrence records81

Data sources8

Biological traits0

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Adoxophyes furcatana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF81 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Adoxophyes furcatana is a species of moth of the family Tortricidae. It is found in eastern North America. The length of the forewings is 7.5–10.5 mm. The forewings are pale yellow with light-brown markings. The hindwings are white. Adults are on wing in June and August. The larvae feed on Platanus species. They roll the leaves of their host plant.TortAI

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoxophyes furcatana has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

59Cmostly conserved

73Amostly conserved

76Amostly conserved

85Amostly conserved

88Tmostly conserved

118Cvariable

127Tmostly conserved

193Cmostly conserved

226Tmostly conserved

232Tmostly conserved

274Cmostly conserved

277Tmostly conserved

287Tmostly conserved

304Tmostly conserved

418Cmostly conserved

484Cmostly conserved

508Amostly conserved

523Tmostly conserved

547Tmostly conserved

556Tmostly conserved

574Tmostly conserved

578Tmostly conserved

616Cmostly conserved

622Amostly conserved

625Cmostly conserved

628Amostly conserved

634Cmostly conserved

646Cmostly conserved

652Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACATCTTTAAGATTACTAATTCGAGCTGAACTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BINs2

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes negundanasame genus3.6%Adoxophyes moderatanasame genus7.9%Adoxophyes parastrophasame genus8.1%Homona mermerodessame family8.1%Archips purpuranasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor20

Museum / vouchered61

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 8≤1 km 6≤10 km 1>10 km 1

16 georeferenced · 4 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 19≤10 km 25>10 km 1

45 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	30
Philadelphia, US	17
Mississippi State, US	7
Washington, US	3
New Haven, US	2
King Saud Universitylocation not on record	1

6 institutions · 60 of 61 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Adoxophyes furcatana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 19.5–22.1

Seasonal swing summer↔winter21.0 °C

Max temp (day)25.8 °C 24.6–27.0

Min temp (night)15.9 °C 14.2–17.5

Precipitation120 mm/mo 116–124

Air humidity59.5 % 58.5–60.5

Moisture balance-24.0 mm/mo -27.4–-20.5

Vapour deficit994 Pa 938–1,050

Wind speed1.90 m/s 1.90–2.00

Cloud cover33.7 % 29.3–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)