Adoxophyes negundana

(McDunnough, 1923) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Adoxophyes

At a glance

Occurrence records358

Data sources8

Biological traits0

DNA specimens24

eDNA detections20

Sources8 archives

Databases and archives Adoxophyes negundana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility358 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF358 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD24 specimens

01Narrative

Adoxophyes negundana, the shimmering adoxophyes moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Ontario to Manitoba, south to Florida and west to Utah. The length of the forewings is 7.5–9.5 mm. The forewings are pale yellow with light-brown markings. The hindwings are white. Adults are on wing in June to early September. The larvae feed on Acer negundo. They roll the leaves of their host plant.TortAI

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoxophyes negundana has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

59Tmostly conserved

76Tmostly conserved

85Tmostly conserved

88Amostly conserved

118Tmostly conserved

127Amostly conserved

193Tmostly conserved

226Cmostly conserved

232Cmostly conserved

274Tmostly conserved

304Cmostly conserved

340Cmostly conserved

355Tmostly conserved

376Amostly conserved

385Tmostly conserved

418Tmostly conserved

484Tmostly conserved

508Tmostly conserved

523Tvariable

544Tmostly conserved

547Cmostly conserved

556Amostly conserved

578Cmostly conserved

616Tmostly conserved

625Tmostly conserved

634Tmostly conserved

646Tmostly conserved

652Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAACTTGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes6

BINs2

Most divergent pair4.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes furcatanasame genus3.6%Choristoneura luticostanasame family6.2%Choristoneura diversanasame family6.2%Choristoneura fumiferanasame family6.4%Choristoneura oraesame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type358 records

Wild obs. + sensor289

Museum / vouchered69

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 198≤1 km 26≤10 km 10>10 km 29

263 georeferenced · 26 without coordinates

Open the mapobservation + sensor289

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	41
Royal Saskatchewan Museumlocation not on record	11
Washington, US	4
East Lansing, US	4
Cornell University Insect Collectionlocation not on record	3
University of Alberta Museums (UAM)location not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
OSUClocation not on record	1

8 institutions · 67 of 69 vouchered records shown · 2 without an institution code

09Environmental DNA20 detections

Where the DNA of Adoxophyes negundana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 17.1–20.4

Seasonal swing summer↔winter30.4 °C

Max temp (day)23.7 °C 21.7–25.3

Min temp (night)13.9 °C 13.1–16.1

Precipitation103 mm/mo 78.3–108

Air humidity58.8 % 56.5–59.7

Moisture balance-39.0 mm/mo -56.6–-9.60

Vapour deficit936 Pa 785–995

Wind speed3.20 m/s 2.50–3.60

Cloud cover45.0 % 41.9–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)