Archips purpurana

(Clemens, 1865) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records2 221

Data sources7

Biological traits0

DNA specimens146

eDNA detections146

Sources7 archives

Databases and archives Archips purpurana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 221 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI146 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics146 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 221 records

Environmental DNA1 datasets · 2 countries146 detections

DNA & barcodingBOLD146 specimens

01Narrative

Archips purpurana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1865 door Clemens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding146 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips purpurana has left across the world's sequence archives.

At a glance

DNA specimens146

BINs2

Marker genes2

eDNA detections146

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus133 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

1Tmostly conserved

56Tmostly conserved

58Amostly conserved

88Amostly conserved

136Cmostly conserved

157Tmostly conserved

190Amostly conserved

205Tvariable

250Cmostly conserved

280Tmostly conserved

386Cmostly conserved

457Tmostly conserved

490Tmostly conserved

508Amostly conserved

542Tmostly conserved

568Cmostly conserved

581Cmostly conserved

589Cmostly conserved

616Tmostly conserved

628Amostly conserved

637Cmostly conserved

646Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes21

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lozotaenia capensanasame family5.4%Choristoneura obsoletanasame family5.5%Aphelia albocilianasame family5.6%Choristoneura houstonanasame family5.6%Lozotaenia cupidinanasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 221 records

Wild obs. + sensor1 658

Museum / vouchered563

Range

Area of Occupancy AOO4 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 980≤1 km 234≤10 km 64>10 km 133

1 411 georeferenced · 247 without coordinates

Open the mapobservation + sensor1 658

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 9≤1 km 101≤10 km 89>10 km 58

257 georeferenced · 306 without coordinates

Open the institutions mapphysical evidence563

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	172
St. Paul, US	64
University of Guelph, Centre for Biodiversity Genomicslocation not on record	61
New Haven, US	46
North Carolina State University Insect Museumlocation not on record	28
Cornell University Insect Collectionlocation not on record	22
University of Alberta Museums (UAM)location not on record	15
Mississippi State, US	14
Cleveland Museum of Natural History, OH (CLEV)location not on record	13
San Francisco, US	9
Royal Saskatchewan Museumlocation not on record	9
OSUClocation not on record	7
University of Guelphlocation not on record	4
Decorah, US	4
Philadelphia, US	3
Vernal, US	2
Chicago, US	1
Washington, US	1
Toronto, CA	1
SOVTlocation not on record	1

20 institutions · 477 of 563 vouchered records shown · 86 without an institution code

09Environmental DNA146 detections

Where the DNA of Archips purpurana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found146

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 146 detections have coordinates

Open the map2 countries0

4. Native GrasslandGrasslandMixed habitatMixed HabitatTemperate mixed forestRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 15.6–21.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.2 °C 16.4–25.9

Min temp (night)16.0 °C 13.4–18.0

Precipitation95.1 mm/mo 78.0–125

Air humidity59.3 % 57.3–74.6

Moisture balance-54.6 mm/mo

Vapour deficit910 Pa 448–1,037

Wind speed3.20 m/s

Cloud cover40.1 % 37.2–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 143 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archips purpurana

At a glance

Sources7 archives

At a glance

Record type2 221 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 221 records