Admontia degeerioides

(Coquillett, 1895) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Admontia

At a glance

Occurrence records13

Data sources7

Biological traits0

DNA specimens14

eDNA detections49

Sources7 archives

Databases and archives Admontia degeerioides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 2 countries49 detections

DNA & barcodingBOLD14 specimens

01Narrative

Admontia degeerioides is a species of bristle fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Admontia degeerioides has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes1

eDNA detections49

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Where individuals differ — all 144 variable positions, in barcode order

10Tmostly conserved

13Tvariable

22Amostly conserved

25Cmostly conserved

38Amostly conserved

40Tmostly conserved

43Tmostly conserved

46Tmostly conserved

50Tmostly conserved

58Tmostly conserved

64Tmostly conserved

67Cvariable

68Amostly conserved

79Tmostly conserved

80Cmostly conserved

85Amostly conserved

89Tmostly conserved

96Tmostly conserved

100Tmostly conserved

106Cvariable

115Tmostly conserved

139Tmostly conserved

154Cmostly conserved

169Amostly conserved

172Tmostly conserved

181Amostly conserved

190Avariable

200Gmostly conserved

202Tmostly conserved

205Amostly conserved

212Tmostly conserved

214Amostly conserved

217Tmostly conserved

220Cmostly conserved

223Amostly conserved

232Amostly conserved

235Cmostly conserved

238Amostly conserved

263Cmostly conserved

265Tmostly conserved

266Cmostly conserved

268Tmostly conserved

271Tmostly conserved

274Tmostly conserved

275Gmostly conserved

277Tmostly conserved

281Amostly conserved

282Tvariable

283Amostly conserved

284Cmostly conserved

286Tmostly conserved

292Gmostly conserved

293Avariable

294Gmostly conserved

295Amostly conserved

298Amostly conserved

299Amostly conserved

301Tmostly conserved

307Amostly conserved

316Amostly conserved

317Amostly conserved

319Tmostly conserved

322Tmostly conserved

325Amostly conserved

328Tmostly conserved

334Amostly conserved

343Amostly conserved

346Tmostly conserved

349Tmostly conserved

353Tmostly conserved

355Tmostly conserved

357Tmostly conserved

361Tmostly conserved

362Gmostly conserved

368Gmostly conserved

369Gmostly conserved

370Amostly conserved

373Amostly conserved

374Gmostly conserved

375Cmostly conserved

376Tmostly conserved

379Tmostly conserved

382Tmostly conserved

386Amostly conserved

389Tmostly conserved

400Amostly conserved

403Tmostly conserved

406Tmostly conserved

421Tmostly conserved

424Tmostly conserved

433Amostly conserved

436Avariable

439Amostly conserved

448Tmostly conserved

451Tmostly conserved

455Gmostly conserved

457Amostly conserved

472Amostly conserved

473Amostly conserved

475Amostly conserved

478Amostly conserved

481Tmostly conserved

483Cmostly conserved

484Tmostly conserved

485Tmostly conserved

487Tmostly conserved

490Cvariable

491Cmostly conserved

492Gmostly conserved

493Tvariable

499Tmostly conserved

500Tmostly conserved

514Cvariable

517Tmostly conserved

518Gvariable

520Amostly conserved

529Tmostly conserved

530Tmostly conserved

532Amostly conserved

536Cmostly conserved

+24 more variable positions not shown

AACTTTATATTTTATTTTTGGAGCCTGATCAGGAATAATTGGTACTTCATTAAGAATTTTAATTCGCACTGAATTAGGTCATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.5%

Haplotypes5

BINs4

Most divergent pair18.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Admontia blandasame genus4.3%Admontia grandicornissame genus7.2%Admontia offellasame genus7.9%Oswaldia spectabilissame family8.1%Allophorocera ferrugineasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor3

Museum / vouchered10

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Washington, US	1

2 institutions · 5 of 10 vouchered records shown · 5 without an institution code

09Environmental DNA49 detections

Where the DNA of Admontia degeerioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map2 countries0

ForestWetlandGrassland1. Forest & WoodlandAgricultural1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 10.0–20.9

Seasonal swing summer↔winter26.7 °C

Max temp (day)21.8 °C 13.3–25.8

Min temp (night)13.4 °C 6.00–16.2

Precipitation95.1 mm/mo 86.6–134

Air humidity59.5 % 55.7–62.8

Moisture balance-36.7 mm/mo -60.7–59.3

Vapour deficit769 Pa 503–1,031

Wind speed3.50 m/s 2.50–4.10

Cloud cover45.2 % 37.7–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)