Admontia blanda

(Fallén, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Admontia

At a glance

Occurrence records394

Data sources7

Biological traits2

DNA specimens9

eDNA detections43

Sources7 archives

Databases and archives Admontia blanda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF394 records

Environmental DNA3 datasets · 5 countries43 detections

DNA & barcodingBOLD9 specimens

01Narrative

Admontia blanda is a species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Admontia blanda has left across the world's sequence archives.

At a glance

DNA specimens9

BINs4

Marker genes1

eDNA detections43

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

34Tmostly conserved

38Amostly conserved

46Tmostly conserved

67Tmostly conserved

79Amostly conserved

88Amostly conserved

118Tmostly conserved

148Gvariable

154Cmostly conserved

178Tvariable

200Amostly conserved

212Tmostly conserved

277Cmostly conserved

292Amostly conserved

293Gmostly conserved

335Gmostly conserved

340Tvariable

353Gmostly conserved

364Tmostly conserved

371Avariable

490Tvariable

518Amostly conserved

581Cmostly conserved

613Tmostly conserved

616Tvariable

625Tmostly conserved

631Gvariable

646Cmostly conserved

655Amostly conserved

AACTTTATATTTTATTTTTGGAGCCTGATCAGGTATAATTGGTACTTCATTAAGAATTTTAATTCGTACTGAATTAGGACATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs4

Most divergent pair3.0%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Admontia degeerioidessame genus4.3%Admontia grandicornissame genus7.8%Admontia offellasame genus7.9%Medina luctuosasame family8.5%Medina quinterisame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type394 records

Wild obs. + sensor184

Museum / vouchered207

Other3

Range

Area of Occupancy AOO868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 86≤1 km 64≤10 km 33

183 georeferenced · 1 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 184≤1 km 9≤10 km 8

201 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	15
University of Tokyo, Department of Zoologylocation not on record	13
SLU Artdatabankenlocation not on record	11
Helsinki, FI	4
Provincia di Livornolocation not on record	2
Finnish Museum of Natural History, Zoological Museumlocation not on record	1
neflocation not on record	1
NCMGlocation not on record	1
Tampere Museum of Natural Historylocation not on record	1

9 institutions · 49 of 207 vouchered records shown · 158 without an institution code

09Environmental DNA43 detections

Where the DNA of Admontia blanda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys3

Countries5

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map5 countries0

ForestUrbanWetland1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland | 1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 12.3–18.6

Seasonal swing summer↔winter28.1 °C

Max temp (day)20.0 °C 16.0–23.4

Min temp (night)12.9 °C 8.80–15.3

Precipitation88.3 mm/mo 55.6–119

Air humidity60.5 % 57.0–63.3

Moisture balance-14.4 mm/mo -59.9–38.4

Vapour deficit723 Pa 550–891

Wind speed2.60 m/s 2.10–3.90

Cloud cover46.6 % 37.4–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)