Allophorocera ferruginea

(Meigen, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Allophorocera

At a glance

Occurrence records548

Data sources7

Biological traits2

DNA specimens58

eDNA detections166

Sources7 archives

Databases and archives Allophorocera ferruginea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility548 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI166 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF548 records

Environmental DNA3 datasets · 5 countries166 detections

DNA & barcodingBOLD58 specimens

01Narrative

Allophorocera ferruginea is a species of fly in the family Tachinidae. It is a Palearctic species found over most of Europe.Fauna Europaea

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allophorocera ferruginea has left across the world's sequence archives.

At a glance

DNA specimens58

BINs1

Marker genes1

eDNA detections166

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

84Cvariable

363Cmostly conserved

585Avariable

606Cvariable

ACTTTATATTTTATTTTTGGAGCTTGATCAAGTATAATTGGAACTTCTTTAAGTATATTAATTCGAATTGAATTAGGTCACCCCGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes4

BIN1

Most divergent pair0.62%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allophorocera occidentalissame genus1.9%Allophorocera aratorsame genus3.7%Zenillia libatrixsame family4.2%Zenillia dolosasame family4.7%Cyzenis ustulatasame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type548 records

Wild obs. + sensor332

Museum / vouchered213

Cultivated / captive3

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 198≤1 km 99≤10 km 24>10 km 1

322 georeferenced · 10 without coordinates

Open the mapobservation + sensor332

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 107≤1 km 27≤10 km 12>10 km 1

147 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence213

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	32
University of Guelph, Centre for Biodiversity Genomicslocation not on record	25
SLU Artdatabankenlocation not on record	21
University of Tokyo, Department of Zoologylocation not on record	8
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Metsähallituslocation not on record	2
NHMOlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1

8 institutions · 93 of 213 vouchered records shown · 120 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA166 detections

Where the DNA of Allophorocera ferruginea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found166

Studies independent surveys3

Countries5

Verifiable raw sequence linked92

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 166 detections have coordinates

Open the map5 countries0

3. Shrubland | 3.1. Subarctic ShrublandForest4. Native Grassland | 4.1. TundraTundra1. Forest & Woodland | 1.1. Boreal Forest4. Native Grassland|4.1. Tundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 10.5–16.2

Seasonal swing summer↔winter24.1 °C

Max temp (day)17.7 °C 14.7–19.7

Min temp (night)10.6 °C 6.40–12.4

Precipitation90.2 mm/mo 56.4–109

Air humidity59.6 % 56.1–62.0

Moisture balance-9.70 mm/mo -47.6–34.0

Vapour deficit624 Pa 505–755

Wind speed2.70 m/s 1.80–4.10

Cloud cover51.3 % 40.6–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 163 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)