Adelphocoris quadripunctatus

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Adelphocoris

At a glance

Occurrence records8 060

Data sources6

Biological traits0

DNA specimens20

eDNA detections6

Sources6 archives

Databases and archives Adelphocoris quadripunctatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 060 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 060 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD20 specimens

01Narrative

Vierpuntsierblindwants is een wants uit de familie van de blindwantsen (Miridae). De soort werd het eerst wetenschappelijk beschreven door Johann Christian Fabricius in 1794.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelphocoris quadripunctatus has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections6

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

5Tmostly conserved

115Tmostly conserved

157Tmostly conserved

163Amostly conserved

184Amostly conserved

187Tmostly conserved

197Cmostly conserved

206Tmostly conserved

223Tmostly conserved

235Cmostly conserved

259Cmostly conserved

266Tmostly conserved

280Tmostly conserved

287Tmostly conserved

292Amostly conserved

318Cmostly conserved

334Amostly conserved

343Gmostly conserved

352Amostly conserved

355Amostly conserved

373Gmostly conserved

379Amostly conserved

385Tmostly conserved

418Amostly conserved

427Tmostly conserved

433Gvariable

436Amostly conserved

442Tmostly conserved

470Cmostly conserved

496Tmostly conserved

505Tmostly conserved

508Amostly conserved

523Cmostly conserved

530Tmostly conserved

535Tmostly conserved

565Gmostly conserved

568Amostly conserved

595Cmostly conserved

607Tmostly conserved

613Cmostly conserved

CACTTTATATTTCATCTTAGGAATATGAGCAGGAATATTAGGAACATCATTAAGATGAATTATTCGAATCGAATTAGGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BINs2

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelphocoris lineolatussame genus2.0%Adelphocoris insignissame genus2.0%Adelphocoris fasciaticollissame genus2.3%Adelphocoris seticornissame genus5.0%Adelphocoris rapidussame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 060 records

Wild obs. + sensor7 587

Museum / vouchered470

Cultivated / captive2

Other1

Range

Area of Occupancy AOO16 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2 196≤1 km 1 194≤10 km 3 365>10 km 61

6 816 georeferenced · 771 without coordinates

Open the mapobservation + sensor7 587

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 165≤1 km 157≤10 km 72

394 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence470

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	56
Tallinn, EE	31
SLU Artdatabankenlocation not on record	27
NHMOlocation not on record	20
Jyväskylä, FI	20
Philadelphia, US	17
UO-CeStuBiolocation not on record	15
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	12
Helsinki, FI	12
neflocation not on record	11
Adam Mickiewicz University in Poznańlocation not on record	10
ZMAAlocation not on record	9
Metsähallituslocation not on record	8
Forssa, FI	7
Natural History Museum, Aarhus Denmarklocation not on record	6
ZSMlocation not on record	4
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Rovaniemi, FI	2
BioFokuslocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
MZLUlocation not on record	2
Friedrich-Schiller-University Jenalocation not on record	1
Winterthur, CH	1

23 institutions · 279 of 470 vouchered records shown · 191 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Adelphocoris quadripunctatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 13.8–22.0

Seasonal swing summer↔winter27.7 °C

Max temp (day)17.4 °C 17.4–24.7

Min temp (night)8.40 °C 8.40–19.5

Precipitation148 mm/mo 94.3–241

Air humidity57.3 % 57.3–63.6

Moisture balance10.2 mm/mo

Vapour deficit670 Pa 670–960

Wind speed4.30 m/s

Cloud cover40.6 % 37.6–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adelphocoris quadripunctatus

At a glance

Sources6 archives

At a glance

Record type8 060 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 060 records