Adelphocoris rapidus

(Say, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Adelphocoris

At a glance

Occurrence records1 106

Data sources6

Biological traits0

DNA specimens51

eDNA detections51

Sources6 archives

Databases and archives Adelphocoris rapidus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 106 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD51 specimens

01Narrative

Adelphocoris lineolatus, common names for which are rapid plant bug or superb plant bug,Common name and description is a species of Hemiptera in the family Miridae, that can be found everywhere in the United States (except for central), and in the Peace–Athabasca Delta, Canada.Distribution The species are larger than other members of the family (7–8 millimetres or 0.28–0.31 inch), and are either yellowish-black or orange-black coloured.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelphocoris rapidus has left across the world's sequence archives.

At a glance

DNA specimens51

BINs1

Marker genes1

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

1Tmostly conserved

100Amostly conserved

178Cmostly conserved

214Tvariable

238Gmostly conserved

262Gmostly conserved

319Amostly conserved

340Cvariable

343Tmostly conserved

382Gmostly conserved

394Cmostly conserved

434Gmostly conserved

514Gmostly conserved

529Cmostly conserved

619Gmostly conserved

TACCCTATATTTTATCTTAGGAATATGAGCAGGAATATTAGGGACATCATTAAGATGAATTATTCGAATTGAATTAGGAATACCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes6

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelphocoris insignissame genus4.4%Adelphocoris piceosetosussame genus4.7%Adelphocoris seticornissame genus5.0%Adelphocoris triannulatussame genus5.1%Adelphocoris lineolatussame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 106 records

Wild obs. + sensor266

Museum / vouchered840

Range

Area of Occupancy AOO1 940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 170≤1 km 25≤10 km 8>10 km 24

227 georeferenced · 39 without coordinates

Open the mapobservation + sensor266

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 15≤1 km 145≤10 km 191>10 km 18

369 georeferenced · 471 without coordinates

Open the institutions mapphysical evidence840

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	356
San Francisco, US	287
Mississippi State, US	62
Provo, US	30
University of Guelph, Centre for Biodiversity Genomicslocation not on record	22
College Station, US	18
Cornell University Insect Collectionlocation not on record	7
Edmonton, CA	7
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
Natural History Museum of Utahlocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
US	2
University of Guelphlocation not on record	1
CUlocation not on record	1
OSUClocation not on record	1
Wuzhou, CN	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

18 institutions · 807 of 840 vouchered records shown · 33 without an institution code

09Environmental DNA51 detections

Where the DNA of Adelphocoris rapidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.1. Boreal ForestForest1. Forest & Woodland|1.4. Temperate Forest4. Native Grassland | 4.4. Temperate GrasslandRiparian Zonegrid 37156

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 12.6–18.1

Seasonal swing summer↔winter25.5 °C

Max temp (day)21.1 °C 16.4–24.5

Min temp (night)10.8 °C 7.90–13.4

Precipitation69.1 mm/mo 23.3–104

Air humidity55.9 % 49.1–64.8

Moisture balance-59.3 mm/mo -119–21.7

Vapour deficit736 Pa 451–1,097

Wind speed2.40 m/s 1.70–5.50

Cloud cover35.5 % 29.9–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adelphocoris rapidus

At a glance

Sources6 archives

At a glance

Record type1 106 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 106 records