Adelphocoris seticornis

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Adelphocoris

At a glance

Occurrence records8 229

Data sources7

Biological traits2

DNA specimens32

eDNA detections95

Sources7 archives

Databases and archives Adelphocoris seticornis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI95 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 229 records

Environmental DNA4 datasets · 12 countries95 detections

DNA & barcodingBOLD32 specimens

01Narrative

Adelphocoris seticornis is a Palearctic species of true bugMamaev B.M. , Medvedev L.N. , Pravdin F.N. Keys to insects of the European part of the USSR. - M .: Education, 1976 .-- P. 87 .-- 304 p.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelphocoris seticornis has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes2

eDNA detections95

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

3Cmostly conserved

10Cmostly conserved

17Cmostly conserved

94Cmostly conserved

118Tvariable

220Tmostly conserved

271Cmostly conserved

274Amostly conserved

364Amostly conserved

400Gmostly conserved

472Gmostly conserved

473Gmostly conserved

474Cmostly conserved

505Cmostly conserved

520Amostly conserved

526Tmostly conserved

535Tmostly conserved

536Cmostly conserved

553Cmostly conserved

653Cvariable

CACTTTATACTTTATCCTAGGAATATGAGCAGGAATATTAGGAACATCATTAAGATGAATTATTCGAATTGAATTAGGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes7

BINs2

Most divergent pair16.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelphocoris lineolatussame genus3.8%Adelphocoris fasciaticollissame genus4.6%Adelphocoris triannulatussame genus4.7%Adelphocoris nigritylussame genus4.8%Adelphocoris insignissame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type8 229 records

Wild obs. + sensor7 461

Museum / vouchered671

Cultivated / captive18

Other79

Range

Area of Occupancy AOO17 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 2 441≤1 km 1 419≤10 km 2 409>10 km 117

6 386 georeferenced · 1 075 without coordinates

Open the mapobservation + sensor7 461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 251≤1 km 173≤10 km 100>10 km 2

526 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence671

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the mapnot free-living18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	79
SLU Artdatabankenlocation not on record	51
Tartu, EE	48
Adam Mickiewicz University in Poznańlocation not on record	41
Natural History Museum, Aarhus Denmarklocation not on record	40
Jyväskylä, FI	23
Bonn, DE	21
Rovaniemi, FI	18
Philadelphia, US	13
neflocation not on record	12
Tallinn, EE	12
Winterthur, CH	11
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	9
Forssa, FI	8
ZMAAlocation not on record	8
Metsähallituslocation not on record	7
ZSMlocation not on record	6
MZLUlocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
UO-CeStuBiolocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
Kuopio, FI	2
BioFokuslocation not on record	2
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
WGSlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Friedrich-Schiller-University Jenalocation not on record	1
Ugentlocation not on record	1
South Kensington, GB	1

29 institutions · 433 of 671 vouchered records shown · 238 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA95 detections

Where the DNA of Adelphocoris seticornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found95

Studies independent surveys4

Countries12

Verifiable raw sequence linked65

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 95 detections have coordinates

Open the map12 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.4–18.2

Seasonal swing summer↔winter19.5 °C

Max temp (day)19.4 °C 16.5–22.4

Min temp (night)12.5 °C 9.60–14.8

Precipitation92.3 mm/mo 67.9–112

Air humidity61.1 % 58.5–62.9

Moisture balance-13.9 mm/mo -49.8–27.7

Vapour deficit724 Pa 600–854

Wind speed2.70 m/s 2.20–4.00

Cloud cover47.3 % 31.5–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 93 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adelphocoris seticornis

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type8 229 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 229 records