Adela flammeusella

Chambers, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records322

Data sources7

Biological traits0

DNA specimens12

eDNA detections14

Sources7 archives

Databases and archives Adela flammeusella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility322 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF322 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD12 specimens

01Narrative

Adela flammeusella is a moth of the family Adelidae or fairy longhorn moths. It was described by Vactor Tousey Chambers in 1876. It is found in the United States from southern Washington south to the foothills and interior valleys of most of cismontane California. The length of the forewings is 5–6 mm. Adults are dark coppery bronze, usually with three to five cream-colored spots in males. Both sexes have metallic purple hindwings.Bug Guide Adults are on wing from late March to early June. The larvae probably feed on various species of Orthocarpus and/or Castilleja.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela flammeusella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

25Tmostly conserved

88Tmostly conserved

160Avariable

169Cvariable

214Amostly conserved

220Tmostly conserved

271Cvariable

298Amostly conserved

316Amostly conserved

346Amostly conserved

370Gvariable

433Tvariable

451Tmostly conserved

460Cmostly conserved

463Tmostly conserved

466Amostly conserved

508Amostly conserved

542Tmostly conserved

553Tmostly conserved

565Amostly conserved

578Tvariable

610Tmostly conserved

622Gmostly conserved

628Gvariable

634Cmostly conserved

AACCCTTTACTTTATTTTCGGAATTTGATCAGGATTATTAGGAACTTCCCTAAGTTTAATTATTCGAACAGAATTAGGAATACCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes7

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cauchas simpliciellasame family7.1%Adela eldoradasame genus7.4%Adela trigraphasame genus7.8%Adela punctiferellasame genus8.1%Adela thorpellasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type322 records

Wild obs. + sensor253

Museum / vouchered69

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 109≤1 km 34≤10 km 7>10 km 21

171 georeferenced · 82 without coordinates

Open the mapobservation + sensor253

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 7≤1 km 23≤10 km 27>10 km 4

61 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	26
New Haven, US	14
Santa Cruz, US	8
Denver, US	5
San Diego, US	4
Washington, US	4
San Francisco, US	3
University of California, Davislocation not on record	2
Essig Museum of Entomologylocation not on record	1

9 institutions · 67 of 69 vouchered records shown · 2 without an institution code

09Environmental DNA14 detections

Where the DNA of Adela flammeusella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 11.4–20.4

Seasonal swing summer↔winter19.6 °C

Max temp (day)23.4 °C 14.7–27.7

Min temp (night)12.7 °C 5.10–13.0

Precipitation59.7 mm/mo 51.7–98.9

Air humidity48.2 % 47.8–55.9

Moisture balance-96.0 mm/mo

Vapour deficit978 Pa 598–1,257

Wind speed2.80 m/s

Cloud cover43.5 % 32.4–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)