Adela trigrapha

Zeller, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records744

Data sources7

Biological traits0

DNA specimens16

eDNA detections7

Sources7 archives

Databases and archives Adela trigrapha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility744 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF744 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD16 specimens

01Narrative

Adela trigrapha is a moth of the family Adelidae or fairy longhorn moths. It was described by Zeller in 1876. It is found in western North America,mothphotographersgroup from Vancouver Island to California. The length of the forewings is 5.5–6.2 mm. Adult males have large eyes and long white antenna (three times the forewing length). The forewings are black and usually crossed by three white lines. Females are smaller and have smaller eyes and antennae. They have a bright orange head. The forewings are bright metallic blue and the hindwings are purple.Bug Guide The larvae possibly feed on Leptosiphon androsaceus and Leptosiphon bicolor.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela trigrapha has left across the world's sequence archives.

At a glance

DNA specimens16

BINs4

Marker genes2

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

22Gmostly conserved

74Cvariable

115Cvariable

193Cvariable

197Tmostly conserved

202Cvariable

235Tmostly conserved

238Avariable

271Tvariable

277Avariable

283Tvariable

340Tmostly conserved

346Amostly conserved

347Cvariable

433Amostly conserved

436Cvariable

445Cvariable

463Tvariable

470Avariable

505Tmostly conserved

517Amostly conserved

542Tvariable

556Amostly conserved

568Tmostly conserved

577Avariable

589Tvariable

616Tmostly conserved

622Amostly conserved

625Tmostly conserved

646Tmostly conserved

AACTCTTTATTTTATTTTCGGGATTTGATCTGGACTTTTAGGAACTTCATTAAGTTTAATTATTCGAACAGAACTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BINs4

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adela thorpellasame genus5.5%Cauchas simpliciellasame family6.2%Adela punctiferellasame genus6.7%Adela vittatasame genus7.0%Adela septentrionellasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type744 records

Wild obs. + sensor643

Museum / vouchered101

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 258≤1 km 106≤10 km 43>10 km 37

444 georeferenced · 199 without coordinates

Open the mapobservation + sensor643

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 35≤1 km 31≤10 km 16>10 km 8

90 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	23
Santa Cruz, US	17
New Haven, US	16
San Francisco, US	12
Washington, US	11
San Diego, US	8
Essig Museum of Entomologylocation not on record	5
East Lansing, US	4
University of California, Davislocation not on record	4
US	1

10 institutions · 101 of 101 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Adela trigrapha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–15.5

Seasonal swing summer↔winter14.6 °C

Max temp (day)21.2 °C 21.2–22.0

Min temp (night)7.50 °C 7.50–8.60

Precipitation44.4 mm/mo 44.4–71.4

Air humidity53.0 % 51.7–53.0

Moisture balance-74.4 mm/mo -74.4–-52.8

Vapour deficit765 Pa 765–853

Wind speed3.30 m/s 3.20–3.30

Cloud cover55.8 % 49.0–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)