Adela thorpella

Powell, 1969 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records50

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Adela thorpella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF50 records

DNA & barcodingBOLD5 specimens

01Narrative

Adela thorpella is a moth of the Adelidae family or fairy longhorn moths. It was described by Powell in 1969. It is found in California. The length of the forewings is 5.7 -. The forewings are olivaceous-bronze, reflecting metallic brass, at times overlaid with pale yellowish scales and either without markings or (more usually) at least a trace of a white spot pattern. The hindwings are brown, faintly reflecting purplish.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela thorpella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BINs2

Most divergent pair2.4%

Where individuals differ — all 17 variable positions, in barcode order

22Gvariable

82Gvariable

97Tvariable

139Cvariable

157Cmostly conserved

271Cvariable

316Avariable

334Tvariable

337Avariable

370Avariable

454Avariable

481Avariable

508Avariable

553Avariable

604Avariable

625Avariable

658Cvariable

AACTCTTTATTTTATTTTTGGGATTTGATCCGGACTTTTAGGAACTTCTTTAAGTTTAATTATTCGAACAGAATTAGGAATGCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adela eldoradasame genus5.2%Adela trigraphasame genus5.5%Cauchas simpliciellasame family6.4%Adela punctiferellasame genus6.4%Cauchas cockerellisame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type50 records

Wild obs. + sensor39

Museum / vouchered11

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 8≤1 km 7≤10 km 3>10 km 2

20 georeferenced · 19 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	7
Essig Museum of Entomologylocation not on record	3
San Francisco, US	1

3 institutions · 11 of 11 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)