Actinote thalia

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Actinote

At a glance

Occurrence records229

Data sources7

Biological traits0

DNA specimens9

eDNA detections3

Sources7 archives

Databases and archives Actinote thalia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF229 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD9 specimens

01Narrative

Actinote thalia is a butterfly of the family Nymphalidae. It was described by Carl Linnaeus in the 1758 10th edition of Systema Naturae. It is found in most of South America. An attempt was made by the South African programme to defoliate the Chromolaena odorata, a shrub of Neotropical origin, by this species, but was disqualified due to an unacceptably wide host range. The larvae feed on Mikania species, Eupatorium odoratum and Chromolaena odoratum."Actinote Hübner, [1819]" at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinote thalia has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAATTGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGTGCCCCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinote anteassame genus2.7%Actinote pelleneasame genus3.5%Actinote melanisanssame genus3.6%Actinote alaliasame genus4.1%Actinote intensasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type229 records

Wild obs. + sensor35

Museum / vouchered161

Other33

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 4≤1 km 10≤10 km 1>10 km 2

17 georeferenced · 18 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 12≤1 km 6≤10 km 39>10 km 34

91 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	59
Museo del Instituto de Zoologia Agricola Francisco Fernandez Yepezlocation not on record	16
The University of the West Indies, Trinidad and Tobagolocation not on record	15
UNICAMPlocation not on record	15
PUC-RSlocation not on record	11
New Haven, US	10
Stockholm, SE	8
MZLUlocation not on record	8
Ciudad de México, MX	5
Uniwersytet Jagiellońskilocation not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Bernardino Rivadavia Natural Sciences Museumlocation not on record	1

13 institutions · 157 of 161 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Actinote thalia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)