Actinote pellenea

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Actinote

At a glance

Occurrence records1 391

Data sources4

Biological traits0

DNA specimens116

eDNA detections105

Sources4 archives

Databases and archives Actinote pellenea's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 391 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI105 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics116 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 391 records

Environmental DNA1 datasets · 5 countries105 detections

DNA & barcodingBOLD116 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding116 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinote pellenea has left across the world's sequence archives.

At a glance

DNA specimens116

BINs2

Marker genes1

eDNA detections105

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

56Cvariable

80Gvariable

82Cmostly conserved

92Tmostly conserved

157Cmostly conserved

193Tmostly conserved

223Tmostly conserved

235Cmostly conserved

335Gmostly conserved

352Cmostly conserved

364Amostly conserved

370Cmostly conserved

406Tmostly conserved

421Tmostly conserved

451Gvariable

523Cmostly conserved

529Cmostly conserved

548Tmostly conserved

634Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAATTGGAACATCTTTAAGTCTATTAATTCGAATAGAATTAGGTGCCCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes14

BINs2

Most divergent pair2.3%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinote thaliasame genus3.5%Actinote anteassame genus4.0%Actinote alaliasame genus5.2%Acraea aceratasame family9.0%Actinote johncoulsonisame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 391 records

Wild obs. + sensor1 037

Museum / vouchered332

Other22

Origin

Native1

Range

Area of Occupancy AOO2 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 442≤1 km 260≤10 km 93>10 km 32

827 georeferenced · 210 without coordinates

Open the mapobservation + sensor1 037

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 1≤1 km 45≤10 km 67>10 km 78

191 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	81
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	67
Bernardino Rivadavia Natural Sciences Museumlocation not on record	34
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	12
The University of the West Indies, Trinidad and Tobagolocation not on record	12
Uniwersytet Jagiellońskilocation not on record	12
Universidad del Quindío (UniQuindío)location not on record	11
Museo del Instituto de Zoologia Agricola Francisco Fernandez Yepezlocation not on record	8
UNICAMPlocation not on record	8
Auckland, NZ	7
Universidad Nacional de Colombia (UNAL)location not on record	7
New Haven, US	6
Natural History Museum Rotterdamlocation not on record	5
Universidad de Antioquia (UdeA)location not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Zürich, CH	3
Natural History Museum of Utahlocation not on record	2
MZLUlocation not on record	2
Jardín Botánico Del Quindío (JBQ)location not on record	2

19 institutions · 288 of 332 vouchered records shown · 44 without an institution code

09Environmental DNA105 detections

Where the DNA of Actinote pellenea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found105

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 105 detections have coordinates

Open the map5 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…Dry forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 16.3–24.8

Seasonal swing summer↔winter10.6 °C

Max temp (day)24.6 °C 19.9–28.6

Min temp (night)17.2 °C 12.1–20.6

Precipitation109 mm/mo 87.2–187

Air humidity63.5 % 58.5–71.1

Moisture balance15.3 mm/mo

Vapour deficit891 Pa 625–1,187

Wind speed1.70 m/s

Cloud cover36.3 % 29.4–63.0

CHELSA 1981–2010, ~9 km grid, at location & month of 83 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Actinote pellenea

At a glance

Sources4 archives

At a glance

Record type1 391 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 391 records