Actinote alalia

Felder, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Actinote

At a glance

Occurrence records16

Data sources6

Biological traits0

DNA specimens12

eDNA detections3

Sources6 archives

Databases and archives Actinote alalia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD12 specimens

01Narrative

Actinote alalia is een vlinder uit de familie van de Nymphalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1860 door Felder.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinote alalia has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.0%

Haplotypes1

BIN1

Where individuals differ — all 30 variable positions, in barcode order

116Cmostly conserved

117Cmostly conserved

150Amostly conserved

151Tmostly conserved

153Cmostly conserved

154Tmostly conserved

164Gmostly conserved

180Tmostly conserved

189Tmostly conserved

194Gmostly conserved

248Gmostly conserved

261Tmostly conserved

337Tmostly conserved

350Gmostly conserved

362Tmostly conserved

390Amostly conserved

405Gmostly conserved

416Gmostly conserved

443Gmostly conserved

498Tmostly conserved

545Gmostly conserved

551Gmostly conserved

553Tmostly conserved

565Tmostly conserved

570Tmostly conserved

580Tmostly conserved

593Gmostly conserved

596Gmostly conserved

637Tmostly conserved

649Tmostly conserved

ATGACTCTTTTCTACTAATCATAAGGATATTGGAACTTTATATTTTATTTTTGGAATTTGATCTGGAATAATTGGAACATCTTTAAGTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actinote thaliasame genus4.1%Actinote anteassame genus4.4%Actinote pelleneasame genus5.2%Actinote melanisanssame genus5.6%Actinote intensasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor1

Museum / vouchered14

Other1

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 14

14 georeferenced

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	14

1 institutions · 14 of 14 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Actinote alalia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)